Transcript: Mouse NM_009612.3

Mus musculus activin A receptor, type II-like 1 (Acvrl1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Acvrl1 (11482)
Length:
3640
CDS:
273..1781

Additional Resources:

NCBI RefSeq record:
NM_009612.3
NBCI Gene record:
Acvrl1 (11482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231257 ACACAGAGAGTCTGGTATTTA pLKO_005 2917 3UTR 100% 15.000 21.000 N Acvrl1 n/a
2 TRCN0000360998 AGAGTGTGGCGGTCAAGATTT pLKO_005 940 CDS 100% 13.200 18.480 N Acvrl1 n/a
3 TRCN0000231253 TGTGTGGGAAAGGGCCGATAT pLKO_005 888 CDS 100% 10.800 15.120 N Acvrl1 n/a
4 TRCN0000361062 GTAACTTGCAGTGTTGCATTG pLKO_005 1288 CDS 100% 6.000 4.800 N Acvrl1 n/a
5 TRCN0000231254 ACCTACATGTGGAGATCTTTG pLKO_005 1204 CDS 100% 10.800 7.560 N Acvrl1 n/a
6 TRCN0000231255 CACTCACAAAGCAGCGATTAC pLKO_005 1332 CDS 100% 10.800 7.560 N Acvrl1 n/a
7 TRCN0000231256 CTGCGCATAAAGAAGACATTG pLKO_005 1716 CDS 100% 10.800 7.560 N Acvrl1 n/a
8 TRCN0000022540 GCACTCACAAAGCAGCGATTA pLKO.1 1331 CDS 100% 10.800 7.560 N Acvrl1 n/a
9 TRCN0000361063 GTGACCTCAAGAGTCGCAATG pLKO_005 1255 CDS 100% 6.000 4.200 N Acvrl1 n/a
10 TRCN0000022541 CCACCTTTCTATGACATGGTA pLKO.1 1536 CDS 100% 3.000 2.100 N Acvrl1 n/a
11 TRCN0000022539 CCCACAGAGTTTCTGAACCAT pLKO.1 510 CDS 100% 3.000 2.100 N Acvrl1 n/a
12 TRCN0000022543 CTGCTATAGATCCTTCTGCAA pLKO.1 536 CDS 100% 2.640 1.848 N Acvrl1 n/a
13 TRCN0000022542 GAAGCCCAAAGTGATTCACTA pLKO.1 1760 CDS 100% 4.950 2.970 N Acvrl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00019 pDONR223 100% 85% 88.4% None (many diffs) n/a
2 ccsbBroad304_00019 pLX_304 0% 85% 88.4% V5 (many diffs) n/a
3 TRCN0000480864 CAATTAGAAGCAACGTGCAGTTCC pLX_317 26.6% 85% 88.4% V5 (many diffs) n/a
4 ccsbBroadEn_14531 pDONR223 0% 85% 88.4% None (many diffs) n/a
5 ccsbBroad304_14531 pLX_304 0% 85% 88.4% V5 (many diffs) n/a
6 TRCN0000467543 CATCCCCTTCAATTACAATCCTTG pLX_317 26% 85% 88.4% V5 (many diffs) n/a
7 TRCN0000489223 TCAATCTATTCAAACCTGCCGTTG pLX_317 21.1% 85% 88.4% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000491521 ACATTGGGACTGTTTCGTTGGCCT pLX_317 18.8% 82% 85.2% V5 (many diffs) n/a
Download CSV