Transcript: Mouse XR_375539.1

PREDICTED: Mus musculus TNNI3 interacting kinase (Tnni3k), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tnni3k (435766)
Length:
2444
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_375539.1
NBCI Gene record:
Tnni3k (435766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_375539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078798 GCCCTCCACATCGCTGCAATA pLKO.1 505 3UTR 100% 3.600 5.040 N Tnni3k n/a
2 TRCN0000085445 CACATCTTTGGCTCTGACGAA pLKO.1 235 3UTR 100% 2.640 3.696 N Tnni3k n/a
3 TRCN0000078802 CTTGACTTGCAGTCTAAATTA pLKO.1 1765 3UTR 100% 15.000 10.500 N Tnni3k n/a
4 TRCN0000085443 CCATCCAGACTGACAAGAAAT pLKO.1 376 3UTR 100% 13.200 9.240 N Tnni3k n/a
5 TRCN0000085444 CGGTGGCAACAAGTCGCATAT pLKO.1 327 3UTR 100% 10.800 7.560 N Tnni3k n/a
6 TRCN0000085446 GAAGATGACCTGCAGATCAAA pLKO.1 190 3UTR 100% 5.625 3.938 N Tnni3k n/a
7 TRCN0000078801 CCAAGGAAATTGTCCACGTAA pLKO.1 950 3UTR 100% 4.950 3.465 N Tnni3k n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_375539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03199 pDONR223 100% 76.1% None (many diffs) n/a
2 ccsbBroad304_03199 pLX_304 0% 76.1% V5 (many diffs) n/a
3 TRCN0000480180 CGTCATCCTCTGGTCACCCTAAGA pLX_317 15.1% 76.1% V5 (many diffs) n/a
Download CSV