Transcript: Mouse NM_001267625.1

Mus musculus D4, zinc and double PHD fingers, family 3 (Dpf3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Dpf3 (70127)
Length:
3155
CDS:
29..1165

Additional Resources:

NCBI RefSeq record:
NM_001267625.1
NBCI Gene record:
Dpf3 (70127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001267625.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086344 CGGGACAGTCATTCCTAATAA pLKO.1 787 CDS 100% 15.000 21.000 N Dpf3 n/a
2 TRCN0000086347 GACAGTCATTCCTAATAACTA pLKO.1 790 CDS 100% 5.625 7.875 N Dpf3 n/a
3 TRCN0000412344 AGATGTTCCCAAGCGCAAGAA pLKO_005 517 CDS 100% 4.950 3.465 N Dpf3 n/a
4 TRCN0000419432 CATCTGTGGCAAGCGCTACAA pLKO_005 631 CDS 100% 4.950 3.465 N Dpf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267625.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07202 pDONR223 100% 76.8% 77.4% None (many diffs) n/a
2 TRCN0000473387 GCCCTCCGGGGAGACATTCACATG pLX_317 40.7% 76.8% 77.4% V5 (many diffs) n/a
Download CSV