Transcript: Human NR_027921.3

Homo sapiens CCL15-CCL14 readthrough (NMD candidate) (CCL15-CCL14), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2018-09-16
Taxon:
Homo sapiens (human)
Gene:
CCL15-CCL14 (348249)
Length:
1464
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027921.3
NBCI Gene record:
CCL15-CCL14 (348249)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057886 GCTGAAGCCCTACTCAATATA pLKO.1 867 3UTR 100% 15.000 7.500 Y CCL15 n/a
2 TRCN0000371599 ACAGAGTTAATGATGTCAAAG pLKO_005 631 3UTR 100% 10.800 5.400 Y CCL15 n/a
3 TRCN0000371655 CCTAGGGACCAAGACTGAATC pLKO_005 1040 3UTR 100% 10.800 5.400 Y CCL14 n/a
4 TRCN0000377734 ATCCCGTGTTCACTCATGAAA pLKO_005 730 3UTR 100% 5.625 2.813 Y CCL15 n/a
5 TRCN0000057849 CAGCGGATTATGGATTACTAT pLKO.1 1176 3UTR 100% 5.625 2.813 Y CCL14 n/a
6 TRCN0000057852 CAAGCCCGGAATTGTCTTCAT pLKO.1 1217 3UTR 100% 4.950 2.475 Y CCL14 n/a
7 TRCN0000057851 CACCTACACTACCTACAAGAT pLKO.1 1148 3UTR 100% 4.950 2.475 Y CCL14 n/a
8 TRCN0000377741 CCAAGCCAGGTGTCATATTCC pLKO_005 779 3UTR 100% 4.950 2.475 Y CCL15 n/a
9 TRCN0000057883 CCAGTAGTTCTGAACAGCTTT pLKO.1 667 3UTR 100% 4.950 2.475 Y CCL15 n/a
10 TRCN0000057884 GCACCTCCTACATCTCACAAA pLKO.1 707 3UTR 100% 4.950 2.475 Y CCL15 n/a
11 TRCN0000377682 AGAGTGCTGCTTCACCTACAC pLKO_005 1136 3UTR 100% 4.050 2.025 Y CCL14 n/a
12 TRCN0000057848 CCAGGACTATATCAAGGACAT pLKO.1 1286 3UTR 100% 4.050 2.025 Y CCL14 n/a
13 TRCN0000057887 CGGGAGTTCAGGATTGCATGA pLKO.1 842 3UTR 100% 4.050 2.025 Y CCL15 n/a
14 TRCN0000377739 AGATCCCGCGTCAGCGGATTA pLKO_005 1165 3UTR 100% 3.600 1.800 Y CCL14 n/a
15 TRCN0000057850 CGGAATTGTCTTCATCACCAA pLKO.1 1223 3UTR 100% 2.640 1.320 Y CCL14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06919 pDONR223 100% 23.1% None 1_546del;886_1464del n/a
2 ccsbBroad304_06919 pLX_304 0% 23.1% V5 1_546del;886_1464del n/a
3 TRCN0000475632 GAGATCTTCCTTTCGAATGGCGTT pLX_317 81.7% 23.1% V5 1_546del;886_1464del n/a
4 ccsbBroadEn_06921 pDONR223 100% 20.3% None (many diffs) n/a
5 ccsbBroad304_06921 pLX_304 0% 20.3% V5 (many diffs) n/a
6 TRCN0000480812 GCTTCGGCTGTTAAGTCCGCCTTC pLX_317 100% 20.3% V5 (many diffs) n/a
7 ccsbBroadEn_01501 pDONR223 100% 19% None 1_989del;1069_1116del;1317_1464del n/a
8 ccsbBroad304_01501 pLX_304 0% 19% V5 1_989del;1069_1116del;1317_1464del n/a
9 TRCN0000479461 AAGCTGACAGAAATTTGGCCGTTG pLX_317 100% 19% V5 1_989del;1069_1116del;1317_1464del n/a
Download CSV