Transcript: Human XM_011536985.1

PREDICTED: Homo sapiens aarF domain containing kinase 1 (ADCK1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCK1 (57143)
Length:
1598
CDS:
147..1037

Additional Resources:

NCBI RefSeq record:
XM_011536985.1
NBCI Gene record:
ADCK1 (57143)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199955 GACCGGGTCTTGGCCCTAATA pLKO.1 990 CDS 100% 4.400 6.160 N ADCK1 n/a
2 TRCN0000195590 CCACTGAGGACTTAGAGATTC pLKO.1 664 CDS 100% 10.800 7.560 N ADCK1 n/a
3 TRCN0000021503 GAAGAAGAATACCTGTTCATT pLKO.1 872 CDS 100% 5.625 3.938 N ADCK1 n/a
4 TRCN0000197048 GAAGACTCAGCAGCCTACATT pLKO.1 1260 3UTR 100% 5.625 3.938 N ADCK1 n/a
5 TRCN0000196277 GCACATGGTCTCTGAATTTGA pLKO.1 1411 3UTR 100% 5.625 3.938 N ADCK1 n/a
6 TRCN0000342867 GCACATGGTCTCTGAATTTGA pLKO_005 1411 3UTR 100% 5.625 3.938 N ADCK1 n/a
7 TRCN0000021502 CTTCAACTTATGGCAGATCAA pLKO.1 926 CDS 100% 4.950 3.465 N ADCK1 n/a
8 TRCN0000197154 GTCTCTGATCTGGACTGACAT pLKO.1 518 CDS 100% 4.950 3.465 N ADCK1 n/a
9 TRCN0000352787 GTCTCTGATCTGGACTGACAT pLKO_005 518 CDS 100% 4.950 3.465 N ADCK1 n/a
10 TRCN0000021499 CCATTCCTGGTATGTGCCATT pLKO.1 1282 3UTR 100% 4.050 2.835 N ADCK1 n/a
11 TRCN0000199293 CCAGAGGAAGTCACACCTCAG pLKO.1 1468 3UTR 100% 0.750 0.525 N ADCK1 n/a
12 TRCN0000021501 CGGAAGAATTCCGCCTGAATT pLKO.1 481 CDS 100% 0.000 0.000 N ADCK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536985.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03795 pDONR223 100% 54.4% 52.3% None (many diffs) n/a
2 ccsbBroad304_03795 pLX_304 0% 54.4% 52.3% V5 (many diffs) n/a
3 TRCN0000472002 CCAATTCCCTATTCTTCGGTAGGT pLX_317 28% 54.4% 52.3% V5 (many diffs) n/a
4 ccsbBroadEn_15119 pDONR223 0% 54.4% 52.3% None (many diffs) n/a
5 ccsbBroad304_15119 pLX_304 0% 54.4% 52.3% V5 (many diffs) n/a
6 TRCN0000467145 AATAATGTTTAACCGTTACCCGGA pLX_317 21.3% 54.4% 52.3% V5 (many diffs) n/a
7 TRCN0000487893 GTTCTAAGCATGATTGCCGCATTA pLX_317 20.1% 54.4% 52.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV