Transcript: Human NR_130933.1

Homo sapiens uncharacterized LOC100288254 (LOC100288254), long non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
LOC100288254 (100288254)
Length:
1802
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130933.1
NBCI Gene record:
LOC100288254 (100288254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167839 GCAGAGTTTATAAGAGTAGAA pLKO.1 1164 3UTR 100% 4.950 6.930 N LOC100288254 n/a
2 TRCN0000168865 CCTTCCAGTGACTGTTTCTTT pLKO.1 1217 3UTR 100% 5.625 3.938 N LOC100288254 n/a
3 TRCN0000167940 CTTGTTATGGTCCCTTCCAAT pLKO.1 635 3UTR 100% 4.950 3.465 N LOC100288254 n/a
4 TRCN0000167543 GAGTAGAAGATACATGAGGTT pLKO.1 1177 3UTR 100% 2.640 1.848 N LOC100288254 n/a
5 TRCN0000166838 CCAGTCAATTCACTTAACTTT pLKO.1 1639 3UTR 100% 5.625 3.375 N LOC100288254 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1500 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1500 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13781 pDONR223 100% 13.4% None (many diffs) n/a
2 ccsbBroad304_13781 pLX_304 0% 13.4% V5 (many diffs) n/a
3 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 13.4% V5 (many diffs) n/a
4 ccsbBroadEn_11616 pDONR223 100% 9.7% None (many diffs) n/a
5 ccsbBroad304_11616 pLX_304 0% 9.7% V5 (many diffs) n/a
6 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 9.7% V5 (many diffs) n/a
Download CSV