Transcript: Human XM_011533563.1

PREDICTED: Homo sapiens POC1 centriolar protein A (POC1A), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POC1A (25886)
Length:
868
CDS:
41..781

Additional Resources:

NCBI RefSeq record:
XM_011533563.1
NBCI Gene record:
POC1A (25886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533563.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078075 CAGTGATGACAAGACTGTTAA pLKO.1 529 CDS 100% 13.200 9.240 N POC1A n/a
2 TRCN0000289356 CAGTGATGACAAGACTGTTAA pLKO_005 529 CDS 100% 13.200 9.240 N POC1A n/a
3 TRCN0000078077 TCTGACGACAAGACAGTCAAA pLKO.1 404 CDS 100% 4.950 3.465 N POC1A n/a
4 TRCN0000078074 CCTGTGTGAACTTCTCTCCTT pLKO.1 234 CDS 100% 2.640 1.848 N POC1A n/a
5 TRCN0000289288 CCTGTGTGAACTTCTCTCCTT pLKO_005 234 CDS 100% 2.640 1.848 N POC1A n/a
6 TRCN0000201937 CCCAATGTCAAAGGTGAGTCA pLKO.1 308 CDS 100% 2.640 1.848 N Poc1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533563.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02878 pDONR223 100% 60.4% 55% None 679_680ins134;738_739ins349 n/a
2 ccsbBroad304_02878 pLX_304 0% 60.4% 55% V5 679_680ins134;738_739ins349 n/a
3 TRCN0000469250 GAACATGTGATCCGCGTTGTGCGT pLX_317 36.9% 60.4% 55% V5 679_680ins134;738_739ins349 n/a
4 ccsbBroadEn_11778 pDONR223 100% 49.8% 44.7% None 1_129del;679_680ins134;738_739ins349 n/a
5 ccsbBroad304_11778 pLX_304 0% 49.8% 44.7% V5 1_129del;679_680ins134;738_739ins349 n/a
6 TRCN0000469531 TGATGTTGGCGCACACCTGGGAAC pLX_317 46.4% 49.8% 44.7% V5 1_129del;679_680ins134;738_739ins349 n/a
Download CSV