Transcript: Human NM_001318900.1

Homo sapiens glutamate dehydrogenase 1 (GLUD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
GLUD1 (2746)
Length:
2946
CDS:
110..1387

Additional Resources:

NCBI RefSeq record:
NM_001318900.1
NBCI Gene record:
GLUD1 (2746)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220878 CCCAAGAACTATACTGATAAT pLKO.1 278 CDS 100% 13.200 7.920 N GLUD1 n/a
2 TRCN0000220881 GCCATTGAGAAAGTCTTCAAA pLKO.1 1334 CDS 100% 5.625 3.375 N GLUD1 n/a
3 TRCN0000343655 GCCATTGAGAAAGTCTTCAAA pLKO_005 1334 CDS 100% 5.625 3.375 N GLUD1 n/a
4 TRCN0000220880 GCAGAGTTCCAAGACAGGATA pLKO.1 1181 CDS 100% 4.950 2.970 N GLUD1 n/a
5 TRCN0000343654 GCAGAGTTCCAAGACAGGATA pLKO_005 1181 CDS 100% 4.950 2.970 N GLUD1 n/a
6 TRCN0000220879 GCTGCCTATGTTAATGCCATT pLKO.1 1319 CDS 100% 4.050 2.430 N GLUD1 n/a
7 TRCN0000036681 CTGGAGAGAAACATTATGGTT pLKO.1 962 CDS 100% 3.000 1.800 N LOC399842 n/a
8 TRCN0000343257 AGCGTTCTGCCAGGCAAATTA pLKO_005 1254 CDS 100% 15.000 7.500 Y GLUD2 n/a
9 TRCN0000343657 GCGTTCTGCCAGGCAAATTAT pLKO_005 1255 CDS 100% 15.000 7.500 Y GLUD1 n/a
10 TRCN0000220866 GCCTACACTCTATGAGATATT pLKO.1 648 CDS 100% 13.200 6.600 Y GLUD2 n/a
11 TRCN0000036682 GTGAGTCTGATGGGAGTATAT pLKO.1 702 CDS 100% 13.200 6.600 Y LOC399842 n/a
12 TRCN0000343656 TCAAGTGAGTTCTTAGTATTT pLKO_005 1830 3UTR 100% 13.200 6.600 Y GLUD1 n/a
13 TRCN0000343202 TGAGTCTGATGGGAGTATATG pLKO_005 703 CDS 100% 13.200 6.600 Y GLUD2 n/a
14 TRCN0000343200 ACGCCTGTGTTACTGGTAAAC pLKO_005 465 CDS 100% 10.800 5.400 Y GLUD2 n/a
15 TRCN0000343598 CACGCCTGTGTTACTGGTAAA pLKO_005 464 CDS 100% 10.800 5.400 Y GLUD1 n/a
16 TRCN0000036680 CCCAAAGGAACTGGAAGACTT pLKO.1 742 CDS 100% 4.950 2.475 Y LOC399842 n/a
17 TRCN0000220882 GCCCTATGAAGGAAGCATCTT pLKO.1 805 CDS 100% 4.950 2.475 Y GLUD1 n/a
18 TRCN0000220864 CCTTCAAATATGAAAGGGATT pLKO.1 1074 CDS 100% 4.050 2.025 Y GLUD2 n/a
19 TRCN0000036683 GCCAAGATCATTGCTGAAGGT pLKO.1 902 CDS 100% 2.640 1.320 Y LOC399842 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06285 pDONR223 100% 75.1% 72.4% None (many diffs) n/a
2 ccsbBroad304_06285 pLX_304 0% 75.1% 72.4% V5 (many diffs) n/a
3 TRCN0000480067 TTGTAGGAGTCTTAGTCTTACGTG pLX_317 21.5% 75.1% 72.4% V5 (many diffs) n/a
4 ccsbBroadEn_10848 pDONR223 100% 61% 60% None (many diffs) n/a
5 ccsbBroad304_10848 pLX_304 0% 61% 60% V5 (many diffs) n/a
6 TRCN0000466896 GGACCGACAGCTTCCTTACACCTG pLX_317 35.2% 61% 60% V5 (many diffs) n/a
Download CSV