Transcript: Human NM_001320886.1

Homo sapiens ATP synthase F1 subunit gamma (ATP5F1C), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ATP5F1C (509)
Length:
1153
CDS:
211..966

Additional Resources:

NCBI RefSeq record:
NM_001320886.1
NBCI Gene record:
ATP5F1C (509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043450 CGTCAGTCATTGCCCTTGAAT pLKO.1 566 CDS 100% 5.625 4.500 N ATP5F1C n/a
2 TRCN0000290959 CGTCAGTCATTGCCCTTGAAT pLKO_005 566 CDS 100% 5.625 4.500 N ATP5F1C n/a
3 TRCN0000043452 GATCTTTAGCTCTGTATGAAA pLKO.1 284 CDS 100% 5.625 3.938 N ATP5F1C n/a
4 TRCN0000290958 GATCTTTAGCTCTGTATGAAA pLKO_005 284 CDS 100% 5.625 3.938 N ATP5F1C n/a
5 TRCN0000043448 GCTGACAGCATGAGTATCTAT pLKO.1 703 CDS 100% 5.625 3.938 N ATP5F1C n/a
6 TRCN0000290960 GCTGACAGCATGAGTATCTAT pLKO_005 703 CDS 100% 5.625 3.938 N ATP5F1C n/a
7 TRCN0000043449 GCATACTTTATAGGACTCATT pLKO.1 485 CDS 100% 4.950 3.465 N ATP5F1C n/a
8 TRCN0000290957 GCATACTTTATAGGACTCATT pLKO_005 485 CDS 100% 4.950 3.465 N ATP5F1C n/a
9 TRCN0000043451 GCTTCTGAGATGATTGACAAA pLKO.1 859 CDS 100% 4.950 3.465 N ATP5F1C n/a
10 TRCN0000307258 GCTTCTGAGATGATTGACAAA pLKO_005 859 CDS 100% 4.950 3.465 N ATP5F1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05868 pDONR223 100% 84.2% 84.2% None 0_1ins141 n/a
2 ccsbBroad304_05868 pLX_304 0% 84.2% 84.2% V5 0_1ins141 n/a
3 TRCN0000472208 TCTAAATCAGCCCGCTCTACAAAA pLX_317 38.1% 84.2% 84.2% V5 0_1ins141 n/a
4 ccsbBroadEn_00128 pDONR223 100% 84.2% 84.2% None 0_1ins141 n/a
5 TRCN0000479997 ACATTTTCTGGAAAAGGTGGAACC pLX_317 45.5% 84.2% 84.2% V5 0_1ins141 n/a
Download CSV