Transcript: Human NM_001283248.2

Homo sapiens transport and golgi organization 2 homolog (TANGO2), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TANGO2 (128989)
Length:
3098
CDS:
106..429

Additional Resources:

NCBI RefSeq record:
NM_001283248.2
NBCI Gene record:
TANGO2 (128989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001283248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437386 GGTTTGCGTGTTACCCATCTG pLKO_005 732 3UTR 100% 4.050 3.240 N TANGO2 n/a
2 TRCN0000413591 CAGTTCAGGGTCTGCCTTTAT pLKO_005 765 3UTR 100% 13.200 9.240 N TANGO2 n/a
3 TRCN0000432420 CTTCACTGAGCGTAGCATGAT pLKO_005 518 3UTR 100% 4.950 3.465 N TANGO2 n/a
4 TRCN0000130981 CCTCCTGATTAGCTGGGATTA pLKO.1 1395 3UTR 100% 10.800 5.400 Y TANGO2 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1531 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1531 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001283248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09518 pDONR223 100% 38.7% 33.6% None 265_266ins340;321_322ins167 n/a
2 ccsbBroad304_09518 pLX_304 0% 38.7% 33.6% V5 265_266ins340;321_322ins167 n/a
3 TRCN0000468437 GCGTGCATTCACTTTCTGTTACAG pLX_317 48.1% 38.7% 33.6% V5 265_266ins340;321_322ins167 n/a
Download CSV