Transcript: Human XM_017019743.1

PREDICTED: Homo sapiens paxillin (PXN), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PXN (5829)
Length:
3921
CDS:
780..2054

Additional Resources:

NCBI RefSeq record:
XM_017019743.1
NBCI Gene record:
PXN (5829)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293921 TGAGCCTTCACCCACCGTAAT pLKO_005 761 5UTR 100% 10.800 15.120 N PXN n/a
2 TRCN0000123134 CCCGACCTAATTGTCTTTGTT pLKO.1 2467 3UTR 100% 5.625 4.500 N PXN n/a
3 TRCN0000286554 CCCGACCTAATTGTCTTTGTT pLKO_005 2467 3UTR 100% 5.625 4.500 N PXN n/a
4 TRCN0000123138 ACCCAACTGGAAACCACACAT pLKO.1 478 5UTR 100% 4.950 3.960 N PXN n/a
5 TRCN0000286555 ACCCAACTGGAAACCACACAT pLKO_005 478 5UTR 100% 4.950 3.960 N PXN n/a
6 TRCN0000123135 CCTGACGAAAGAGAAGCCTAA pLKO.1 968 CDS 100% 4.050 3.240 N PXN n/a
7 TRCN0000293920 GGCCATCCTGGAGAACTATAT pLKO_005 1721 CDS 100% 13.200 9.240 N PXN n/a
8 TRCN0000123136 CCCAACTGGAAACCACACATA pLKO.1 479 5UTR 100% 4.950 3.465 N PXN n/a
9 TRCN0000123137 GCCTTACTGTCAGAACTGCTT pLKO.1 2015 CDS 100% 2.640 1.848 N PXN n/a
10 TRCN0000286485 GCCTTACTGTCAGAACTGCTT pLKO_005 2015 CDS 100% 2.640 1.848 N PXN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06826 pDONR223 100% 76% 75.9% None 0_1ins399;1262A>G n/a
2 ccsbBroad304_06826 pLX_304 0% 76% 75.9% V5 0_1ins399;1262A>G n/a
3 TRCN0000477826 GCCAGAAGTTGGATACTCGACTGT pLX_317 18.8% 76% 75.9% V5 0_1ins399;1262A>G n/a
Download CSV