Transcript: Human XM_017024763.1

PREDICTED: Homo sapiens prohibitin (PHB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHB (5245)
Length:
1999
CDS:
241..1059

Additional Resources:

NCBI RefSeq record:
XM_017024763.1
NBCI Gene record:
PHB (5245)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029204 CCCAGAAATCACTGTGAAATT pLKO.1 1142 3UTR 100% 13.200 9.240 N PHB n/a
2 TRCN0000342682 CCCAGAAATCACTGTGAAATT pLKO_005 1142 3UTR 100% 13.200 9.240 N PHB n/a
3 TRCN0000029208 GAGTTCACAGAAGCGGTGGAA pLKO.1 772 CDS 100% 2.640 1.848 N PHB n/a
4 TRCN0000342748 GAGTTCACAGAAGCGGTGGAA pLKO_005 772 CDS 100% 2.640 1.848 N PHB n/a
5 TRCN0000029207 GCTGCCGTCCATCACAACTGA pLKO.1 594 CDS 100% 1.000 0.700 N PHB n/a
6 TRCN0000342747 GCTGCCGTCCATCACAACTGA pLKO_005 594 CDS 100% 1.000 0.700 N PHB n/a
7 TRCN0000313253 ATCACTTCAGATCTCTAATTA pLKO_005 1199 3UTR 100% 15.000 9.000 N Phb n/a
8 TRCN0000029206 CGTGGTGAACTCTGCCTTATA pLKO.1 303 CDS 100% 13.200 7.920 N PHB n/a
9 TRCN0000342746 CGTGGTGAACTCTGCCTTATA pLKO_005 303 CDS 100% 13.200 7.920 N PHB n/a
10 TRCN0000029205 CCGTGGGTACAGAAACCAATT pLKO.1 415 CDS 100% 10.800 6.480 N PHB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01186 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01186 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470466 TCCAGATTTCTTTGATAACCTCGT pLX_317 37.3% 100% 100% V5 n/a
4 ccsbBroadEn_13707 pDONR223 100% 61.2% 57% None (many diffs) n/a
5 ccsbBroad304_13707 pLX_304 0% 61.2% 57% V5 (many diffs) n/a
6 TRCN0000471347 GTTAATCGACCCTGTTAGTCCATC pLX_317 82% 61.2% 57% V5 (many diffs) n/a
7 ccsbBroadEn_12857 pDONR223 100% 53% 49.6% None (many diffs) n/a
8 ccsbBroad304_12857 pLX_304 0% 53% 49.6% V5 (many diffs) n/a
9 TRCN0000466640 CTATATCTGCGACTTATCGGCCCC pLX_317 67% 53% 49.6% V5 (many diffs) n/a
Download CSV