Transcript: Human XM_017013929.1

PREDICTED: Homo sapiens protein serine kinase H2 (PSKH2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSKH2 (85481)
Length:
2868
CDS:
1..1515

Additional Resources:

NCBI RefSeq record:
XM_017013929.1
NBCI Gene record:
PSKH2 (85481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013929.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003215 CGGGTTAGCCATCGTTACATT pLKO.1 697 CDS 100% 5.625 7.875 N PSKH2 n/a
2 TRCN0000003216 TGATGGGATTAGGTATTTGCA pLKO.1 861 CDS 100% 3.000 4.200 N PSKH2 n/a
3 TRCN0000199194 CAGAGGGCCATATCCCGAAAC pLKO.1 1354 CDS 100% 2.000 2.800 N PSKH2 n/a
4 TRCN0000199480 GAGAGCCTTGGCCAAGCATTT pLKO.1 1205 CDS 100% 10.800 7.560 N PSKH2 n/a
5 TRCN0000195178 CATAGGAATCTAAAGCCTGAA pLKO.1 898 CDS 100% 4.050 2.835 N PSKH2 n/a
6 TRCN0000003217 GAGGATCAAGTTTACATGGTA pLKO.1 745 CDS 100% 3.000 2.100 N PSKH2 n/a
7 TRCN0000003214 GAGCAGAAGACCACCAAGAAA pLKO.1 598 CDS 100% 5.625 3.375 N PSKH2 n/a
8 TRCN0000003218 ACTGGACAATGAAGACACTCT pLKO.1 1004 CDS 100% 2.640 1.584 N PSKH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013929.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09268 pDONR223 100% 76.3% 68.6% None 1_286del;470_540del n/a
2 ccsbBroad304_09268 pLX_304 0% 76.3% 68.6% V5 1_286del;470_540del n/a
3 TRCN0000479043 CTTTTACCTGAGTGCGAGCTCCGA pLX_317 38.4% 76.3% 68.6% V5 1_286del;470_540del n/a
4 TRCN0000487738 AAGGCGTCTGTAGCGGGATATGTA pLX_317 18.4% 76.3% 68.6% V5 (not translated due to prior stop codon) 1_286del;470_540del n/a
Download CSV