Transcript: Human XM_005251994.3

PREDICTED: Homo sapiens muscle associated receptor tyrosine kinase (MUSK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MUSK (4593)
Length:
9001
CDS:
717..3356

Additional Resources:

NCBI RefSeq record:
XM_005251994.3
NBCI Gene record:
MUSK (4593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002167 GTCATTTACTACGTGCGAGAT pLKO.1 3177 CDS 100% 4.050 3.240 N MUSK n/a
2 TRCN0000356242 GACTGCCACATCTAGATTATA pLKO_005 2092 CDS 100% 15.000 10.500 N MUSK n/a
3 TRCN0000356283 ACATGCATAGCTACCAATAAG pLKO_005 1587 CDS 100% 13.200 9.240 N MUSK n/a
4 TRCN0000361449 ACATGCATAGCTACCAATAAG pLKO_005 1587 CDS 100% 13.200 9.240 N Musk n/a
5 TRCN0000195290 CAAGTGAAGATGAAACCTAAA pLKO.1 1062 CDS 100% 10.800 7.560 N MUSK n/a
6 TRCN0000002166 GCAGACTACTACAAAGCTAAT pLKO.1 3003 CDS 100% 10.800 7.560 N MUSK n/a
7 TRCN0000002165 CCAGGACTCTACACATGCATA pLKO.1 1575 CDS 100% 4.950 3.465 N MUSK n/a
8 TRCN0000002164 GTAAGTTTGTTCACCGAGATT pLKO.1 2902 CDS 100% 4.950 3.465 N MUSK n/a
9 TRCN0000356243 GGCCCATGAGGAGGTCATTTA pLKO_005 3164 CDS 100% 13.200 7.920 N MUSK n/a
10 TRCN0000010683 GCCTGGAATGAACTGAAAGTA pLKO.1 1809 CDS 100% 5.625 3.375 N MUSK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14704 pDONR223 0% 98.8% 98.8% None 375T>C;628_657del n/a
2 ccsbBroad304_14704 pLX_304 0% 98.8% 98.8% V5 375T>C;628_657del n/a
3 ccsbBroadEn_06606 pDONR223 100% 89% 88.9% None 402G>A;949_1212del;1391_1414del n/a
4 ccsbBroad304_06606 pLX_304 0% 89% 88.9% V5 402G>A;949_1212del;1391_1414del n/a
5 TRCN0000465498 ACCCGCCCGAGAACTTTAAAAATA pLX_317 15.3% 89% 88.9% V5 402G>A;949_1212del;1391_1414del n/a
6 TRCN0000488630 CAGTCTGCATCGTGCCGCATACGT pLX_317 24% 36% 36% V5 (not translated due to prior stop codon) 1_1686del n/a
Download CSV