Transcript: Human XM_011529768.2

PREDICTED: Homo sapiens RUNX family transcription factor 1 (RUNX1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RUNX1 (861)
Length:
5772
CDS:
227..1438

Additional Resources:

NCBI RefSeq record:
XM_011529768.2
NBCI Gene record:
RUNX1 (861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338428 CTACGATCAGTCCTACCAATA pLKO_005 835 CDS 100% 10.800 15.120 N RUNX1 n/a
2 TRCN0000013658 GCCTTGAAATACCTGTTTCTT pLKO.1 4641 3UTR 100% 5.625 7.875 N RUNX1 n/a
3 TRCN0000013659 CCTACGATCAGTCCTACCAAT pLKO.1 834 CDS 100% 4.950 6.930 N RUNX1 n/a
4 TRCN0000013661 CGGTCGAAGTGGAAGAGGGAA pLKO.1 679 CDS 100% 0.880 1.232 N RUNX1 n/a
5 TRCN0000338492 TCGCCCTGTTTGGCATCTAAT pLKO_005 1896 3UTR 100% 13.200 9.240 N RUNX1 n/a
6 TRCN0000358353 TTCGTACCCACAGTGCTTCAT pLKO_005 259 CDS 100% 4.950 3.465 N RUNX1 n/a
7 TRCN0000338427 GAACCAGGTTGCAAGATTTAA pLKO_005 643 CDS 100% 15.000 9.000 N RUNX1 n/a
8 TRCN0000358352 CTGTGATGGCTGGCAATGATG pLKO_005 579 CDS 100% 4.950 2.970 N RUNX1 n/a
9 TRCN0000013662 CACAGTGCTTCATGAGAGAAT pLKO.1 267 CDS 100% 4.950 3.465 N RUNX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00229 pDONR223 100% 83.9% 83.7% None 57_58ins39;574_575ins192 n/a
2 TRCN0000476234 ATTTCTAGGCCACCTCGTTGAGCA pLX_317 15.9% 83.9% 83.7% V5 57_58ins39;574_575ins192 n/a
Download CSV