Transcript: Human XM_005270590.2

PREDICTED: Homo sapiens coiled-coil and C2 domain containing 1B (CC2D1B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CC2D1B (200014)
Length:
7602
CDS:
238..2814

Additional Resources:

NCBI RefSeq record:
XM_005270590.2
NBCI Gene record:
CC2D1B (200014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168106 CGGAAAGTCAACTTTGCTGAA pLKO.1 1531 CDS 100% 4.050 3.240 N CC2D1B n/a
2 TRCN0000434529 AGGCACGGAAACTGCAGTATC pLKO_005 1859 CDS 100% 10.800 7.560 N CC2D1B n/a
3 TRCN0000418650 AGTTTGAGATCTTCCACAAAG pLKO_005 2573 CDS 100% 10.800 7.560 N CC2D1B n/a
4 TRCN0000172915 GCTGGAGAATGAGTGTGAGAT pLKO.1 2649 CDS 100% 4.950 3.465 N CC2D1B n/a
5 TRCN0000168666 GCTCAAGAACTGAGCTTTGTA pLKO.1 3988 3UTR 100% 0.563 0.394 N CC2D1B n/a
6 TRCN0000172971 GCCTCAAGTTCTAAGGAGTCA pLKO.1 1801 CDS 100% 2.640 1.584 N CC2D1B n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5845 3UTR 100% 13.200 6.600 Y LIAS n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4393 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4393 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14427 pDONR223 100% 61.1% 60.1% None (many diffs) n/a
2 ccsbBroad304_14427 pLX_304 0% 61.1% 60.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471693 GACGGCAGGGCAGTCACCTAAGGA pLX_317 22.7% 61.1% 60.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_13380 pDONR223 100% 18.4% 18.4% None 1_2100del n/a
5 ccsbBroad304_13380 pLX_304 0% 18.4% 18.4% V5 1_2100del n/a
6 TRCN0000467342 ATAAAATCCCCCATTCACTACGTG pLX_317 88.2% 18.4% 18.4% V5 1_2100del n/a
Download CSV