Construct: ORF TRCN0000471693
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000144.1_s317c1
- Derived from:
- ccsbBroadEn_14427
- DNA Barcode:
- GACGGCAGGGCAGTCACCTAAGGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- CC2D1B (200014)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471693
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | XM_017000559.1 | 96.4% | 94.8% | (many diffs) |
2 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | XM_024453857.1 | 96.4% | 94.8% | (many diffs) |
3 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | XM_005270593.2 | 95.4% | 93.8% | (many diffs) |
4 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | NM_001330585.2 | 61.5% | 60.5% | (many diffs) |
5 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | NM_032449.2 | 61.1% | 60.1% | (many diffs) |
6 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | XM_005270590.2 | 61.1% | 60.1% | (many diffs) |
7 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | XM_006710423.2 | 56.2% | 55.2% | (many diffs) |
8 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | XR_001737029.1 | 45.6% | (many diffs) | |
9 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | XR_001737027.1 | 20.7% | (many diffs) | |
10 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | XR_001737028.1 | 19% | (many diffs) | |
11 | human | 200014 | CC2D1B | coiled-coil and C2 domain c... | XR_002959657.1 | 18.6% | (many diffs) | |
12 | mouse | 319965 | Cc2d1b | coiled-coil and C2 domain c... | XM_006503154.2 | 74.9% | 73.6% | (many diffs) |
13 | mouse | 319965 | Cc2d1b | coiled-coil and C2 domain c... | XM_006503152.3 | 55.1% | 54.1% | (many diffs) |
14 | mouse | 319965 | Cc2d1b | coiled-coil and C2 domain c... | NM_177045.3 | 53% | 52% | (many diffs) |
15 | mouse | 319965 | Cc2d1b | coiled-coil and C2 domain c... | XR_376327.1 | 40.7% | (many diffs) | |
16 | mouse | 319965 | Cc2d1b | coiled-coil and C2 domain c... | XR_376326.1 | 39.8% | (many diffs) | |
17 | mouse | 319965 | Cc2d1b | coiled-coil and C2 domain c... | XR_376325.2 | 39.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1635
- ORF length:
- 1569
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gattgggaag agattcggtg ctgtcctgga ggccctggag aaggggcagc 121 ccgtggatct gagtgccatg cccccggcac ctgaggatct gaagccccag caggcttctc 181 aggctcccac agcaccctca gtcattcccc cagccgtgga gcgagtgcag ccagtgatgg 241 cccctgacgt cccagcaacc ccagtggccc ctacagagtc acagacagtg ctggatgccc 301 tgcagcagag gctgaacaag taccgcgagg cgggcatcca ggcccggagt ggtggggacg 361 agcgcaaggc tcggatgcat gagcgcattg ccaagcaata tcaagatgct attcgagcac 421 accgagcagg acggaaagtc aactttgctg aattgcctgt tcctccagga tttcccccca 481 tccctggcct ggagtccact atgggtgttg aggaggacgc agtggcagcg acattggcag 541 ctgcagagaa actggcctct gcagaggatt cagccccggc tgataaagac gaggacgagg 601 gtgagccccc agcacaggcc ccagtggcca agaaacctgc acggcccaca gtcccttcat 661 cccagcgcct gcctgagccc agggcctcaa gttctaagga gtcaccgagt ccatctgtgc 721 gggagcagct ggcactgctg gaggcacgga aactgcagta tcagcgggca gccctgcagg 781 ccaagcgcag ccaggacctg gagcaggcca aagcctatct gcgggtagcc aaatggcttg 841 aggctcagat catccaggcc cgatctggca gacctgttga tctgtccaag gtgccttcgc 901 ccttgacgga tgaggagggt gacttcatcc tcatccacca tgaggacctg cgactctccc 961 agaaggcgga ggaggtgtat gcccagctgc aaaaaatgct tctggagcaa caagagaagt 1021 gcctgctgtt ctccaagcag ttcatgcacc agggcaacgt ggctgagacc acccgatttg 1081 agaagcttgc tcaggaccgc aagaaacagc tggagatcct gcagctggcc caggctcagg 1141 gcctcgaccc tcccacccac cactttgagt tgaagacatt ccagactgtg aggatcttct 1201 cagaactcaa cagcacagaa atgcatctga tcattgtccg gggaatgaac ctcccagccc 1261 ctccaggggt gactcccgat gacctggatg cttttgtgcg gtttGAGTTT CACTACCCTA 1321 ACTCGGACCA GGCTCAAAAA AGCAAAACAG CTGTGGTGAA GAACACAAAC TCTCCAGAAT 1381 TTGATCAACT CTTCAAACTA AACATCAACC GAAACCACCG GGGCTTCAAG AGGGTGATCC 1441 AGAGCAAAGG CATCAAGTTT GAGATCTTCC ACAAAGGGTC CTTCTTCAGA AGCGACAAGC 1501 TGGTTGGCAC AGCACACCTG AAACTGGAGC GGCTGGAGAA TGAGTGTGAG ATCAGAGAAA 1561 TTGTGGAGGT CCTGGATGGA AGGAAGCCCA CCGGGGGGAA GCTGGAGGTG AAGCCGATGG 1621 CCAGCACCAG GAGATGAGTC AGGCCGCGAC TGTGCAGGAG ATGCCCAACT TTCTTGTACA 1681 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1741 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1801 AGGACGAGAC GGCAGGGCAG TCACCTAAGG AACGCGTTAA GTCgacaatc aacctctgga 1861 ttacaaaatt tgtgaaagat t