Transcript: Human XR_001745493.1

PREDICTED: Homo sapiens mitogen-activated protein kinase 15 (MAPK15), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAPK15 (225689)
Length:
1854
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001745493.1
NBCI Gene record:
MAPK15 (225689)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001745493.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002214 AGAGAACGACAGGGACATTTA pLKO.1 1125 3UTR 100% 13.200 18.480 N MAPK15 n/a
2 TRCN0000199135 CACTGACCTGAACGCAGTCAT pLKO.1 1167 3UTR 100% 4.950 6.930 N MAPK15 n/a
3 TRCN0000344522 CACTGACCTGAACGCAGTCAT pLKO_005 1167 3UTR 100% 4.950 6.930 N MAPK15 n/a
4 TRCN0000038662 CCGTCCAATGTGCTCCTGGAT pLKO.1 1297 3UTR 100% 0.880 0.704 N MAPK15 n/a
5 TRCN0000332982 CCGTCCAATGTGCTCCTGGAT pLKO_005 1297 3UTR 100% 0.880 0.704 N MAPK15 n/a
6 TRCN0000344589 TTACCTGGTGTTTGAGTTTAT pLKO_005 1143 3UTR 100% 13.200 9.240 N MAPK15 n/a
7 TRCN0000038660 AGGGACATTTACCTGGTGTTT pLKO.1 1135 3UTR 100% 4.950 3.465 N MAPK15 n/a
8 TRCN0000038663 GCAGAGAACGACAGGGACATT pLKO.1 1123 3UTR 100% 4.950 3.465 N MAPK15 n/a
9 TRCN0000199957 GCCTATGGCATTGTGTGGAAG pLKO.1 889 3UTR 100% 4.050 2.835 N MAPK15 n/a
10 TRCN0000038661 GCTGCTCTCTTCGCACCGATA pLKO.1 1443 3UTR 100% 1.350 0.945 N MAPK15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001745493.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13442 pDONR223 100% 39.8% None (many diffs) n/a
2 ccsbBroad304_13442 pLX_304 0% 39.8% V5 (many diffs) n/a
3 TRCN0000472496 GTTTGCACAACACTACCCAGAAGC pLX_317 50.1% 39.8% V5 (many diffs) n/a
4 ccsbBroadEn_15292 pDONR223 0% 39.8% None (many diffs) n/a
5 ccsbBroad304_15292 pLX_304 0% 39.8% V5 (many diffs) n/a
6 TRCN0000466886 AGCTTAAAAACTGCCTTGGATCCA pLX_317 49.4% 39.8% V5 (many diffs) n/a
7 TRCN0000487795 GTTGGATCTCCTAGATTATTCGTA pLX_317 30% 39.8% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488616 GCTGCGAAAACTGGTTGGAGTGAT pLX_317 15% 38.1% V5 (many diffs) n/a
9 TRCN0000489042 TAACCAACGAGCTATTCGTATTTG pLX_317 18.7% 38.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV