Transcript: Human XM_011542038.2

PREDICTED: Homo sapiens synaptonemal complex protein 1 (SYCP1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYCP1 (6847)
Length:
2716
CDS:
68..2365

Additional Resources:

NCBI RefSeq record:
XM_011542038.2
NBCI Gene record:
SYCP1 (6847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151562 GTGTAGTTAAGGAGCCTAATA pLKO.1 2379 3UTR 100% 13.200 18.480 N SYCP1 n/a
2 TRCN0000150974 CCAATCTCAAAGCTGAACTTT pLKO.1 1695 CDS 100% 5.625 7.875 N SYCP1 n/a
3 TRCN0000151126 GCAGGTATCACTACTATTGAT pLKO.1 232 CDS 100% 5.625 7.875 N SYCP1 n/a
4 TRCN0000150600 GAGCCTAATAACGTGAAACTT pLKO.1 2390 3UTR 100% 5.625 4.500 N SYCP1 n/a
5 TRCN0000367933 ACAAACTGTATCTCGAAATTT pLKO_005 1885 CDS 100% 15.000 10.500 N SYCP1 n/a
6 TRCN0000360117 TGTAGTTAAGGAGCCTAATAA pLKO_005 2380 3UTR 100% 15.000 10.500 N SYCP1 n/a
7 TRCN0000151935 CACACAGGAAACAAGTGATAT pLKO.1 1024 CDS 100% 13.200 9.240 N SYCP1 n/a
8 TRCN0000360116 TGATAAGCGATGTCAACATAA pLKO_005 1531 CDS 100% 13.200 9.240 N SYCP1 n/a
9 TRCN0000151200 GCAACAAGCTTTCACTAGAAA pLKO.1 993 CDS 100% 5.625 3.938 N SYCP1 n/a
10 TRCN0000151776 CTTCACAAACTGTATCTCGAA pLKO.1 1881 CDS 100% 2.640 1.848 N SYCP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01631 pDONR223 100% 78.3% 78.3% None 0_1ins633 n/a
2 ccsbBroad304_01631 pLX_304 0% 78.3% 78.3% V5 0_1ins633 n/a
3 TRCN0000477850 TACATCGAAATTTTCCAAGAGGCC pLX_317 16.5% 78.3% 78.3% V5 0_1ins633 n/a
Download CSV