Transcript: Human XM_017015200.1

PREDICTED: Homo sapiens zinc finger CCHC-type containing 7 (ZCCHC7), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZCCHC7 (84186)
Length:
2884
CDS:
966..2003

Additional Resources:

NCBI RefSeq record:
XM_017015200.1
NBCI Gene record:
ZCCHC7 (84186)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419048 ATATCCATGGAGATCTCAATT pLKO_005 2151 3UTR 100% 13.200 18.480 N ZCCHC7 n/a
2 TRCN0000428433 TCCGAGAGGTCATGATTATAG pLKO_005 861 5UTR 100% 13.200 18.480 N ZCCHC7 n/a
3 TRCN0000412979 ATTCGGAATCTTCGAGTAGTA pLKO_005 597 5UTR 100% 4.950 6.930 N ZCCHC7 n/a
4 TRCN0000033993 CAATCTAATGAGCTGGTTGAT pLKO.1 785 5UTR 100% 4.950 6.930 N ZCCHC7 n/a
5 TRCN0000033991 CGAGATGAGTCATCTAGTGAA pLKO.1 467 5UTR 100% 4.950 6.930 N ZCCHC7 n/a
6 TRCN0000033989 GCGGTACTATTCAGCCAACAA pLKO.1 1067 CDS 100% 4.950 6.930 N ZCCHC7 n/a
7 TRCN0000033992 GTCTCCAGTATCTCCATTCAT pLKO.1 1484 CDS 100% 5.625 4.500 N ZCCHC7 n/a
8 TRCN0000414420 ATATTGAGAAGCCTAAATCTG pLKO_005 822 5UTR 100% 4.950 3.960 N ZCCHC7 n/a
9 TRCN0000417576 AGATAGCTAATAACCGAACAC pLKO_005 1030 CDS 100% 4.050 3.240 N ZCCHC7 n/a
10 TRCN0000421935 TACTTTGGAAAGGACAATAAC pLKO_005 2426 3UTR 100% 13.200 9.240 N ZCCHC7 n/a
11 TRCN0000432864 AGAAGCCTTCTAAGCCCTTTC pLKO_005 1837 CDS 100% 6.000 4.200 N ZCCHC7 n/a
12 TRCN0000033990 CCACACGTCAAGAGAAGACAA pLKO.1 1874 CDS 100% 4.950 3.465 N ZCCHC7 n/a
13 TRCN0000429041 GAGGTCATCACTTTGTCTGAT pLKO_005 683 5UTR 100% 4.950 3.465 N ZCCHC7 n/a
14 TRCN0000418762 GGCCATTATGGACACGAATGT pLKO_005 1440 CDS 100% 4.950 3.465 N ZCCHC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10214 pDONR223 100% 63.6% 60.1% None 0_1ins547;58_59ins44 n/a
2 ccsbBroad304_10214 pLX_304 0% 63.6% 60.1% V5 0_1ins547;58_59ins44 n/a
3 TRCN0000469258 CCCTGCAGGCCGTATCTATACCTG pLX_317 24.9% 63.6% 60.1% V5 0_1ins547;58_59ins44 n/a
4 ccsbBroadEn_12789 pDONR223 100% 20.8% 4.5% None (many diffs) n/a
5 ccsbBroad304_12789 pLX_304 0% 20.8% 4.5% V5 (many diffs) n/a
6 TRCN0000472866 AGCCTCCCCAACCATTTCCGTCCC pLX_317 20.9% 20.8% 4.5% V5 (many diffs) n/a
Download CSV