Transcript: Mouse XM_006525681.3

PREDICTED: Mus musculus 5 hydroxytryptamine (serotonin) receptor 4 (Htr4), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Htr4 (15562)
Length:
10043
CDS:
1979..3112

Additional Resources:

NCBI RefSeq record:
XM_006525681.3
NBCI Gene record:
Htr4 (15562)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525681.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026304 GCTGGCCTATTACCGAATCTA pLKO.1 2605 CDS 100% 5.625 7.875 N Htr4 n/a
2 TRCN0000026249 CCCTTCTTTGTCACCAATATT pLKO.1 2798 CDS 100% 15.000 10.500 N Htr4 n/a
3 TRCN0000026261 CCTTCCCATGTTTATATCTTT pLKO.1 2419 CDS 100% 5.625 3.938 N Htr4 n/a
4 TRCN0000026284 GCCTTTGGTTTATAGGAACAA pLKO.1 2353 CDS 100% 4.950 3.465 N Htr4 n/a
5 TRCN0000356467 CTCATGGTGCTGGCCTATTAC pLKO_005 2597 CDS 100% 13.200 7.920 N HTR4 n/a
6 TRCN0000026270 CCTCACAGCAACTTCTCCTTT pLKO.1 3155 3UTR 100% 4.950 2.970 N Htr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525681.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488893 GTTCTTTGTCAGGGTACTATTGAA pLX_317 29.3% 85.7% 84.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488651 AGCATCTACCCAGGGCGTAGTTTG pLX_317 30.8% 85.6% 84.3% V5 (many diffs) n/a
Download CSV