Transcript: Mouse XR_001781084.1

PREDICTED: Mus musculus muscleblind-like 2 (Mbnl2), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mbnl2 (105559)
Length:
5808
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781084.1
NBCI Gene record:
Mbnl2 (105559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102456 CCGTTTGTATGGATTACATAA pLKO.1 1336 3UTR 100% 13.200 18.480 N Mbnl2 n/a
2 TRCN0000102457 CGTAACCGTTTGTATGGATTA pLKO.1 1331 3UTR 100% 10.800 15.120 N Mbnl2 n/a
3 TRCN0000147101 CGTAACCGTTTGTATGGATTA pLKO.1 1331 3UTR 100% 10.800 15.120 N MBNL2 n/a
4 TRCN0000178919 CAACACCGTAACCGTTTGTAT pLKO.1 1325 3UTR 100% 5.625 7.875 N MBNL2 n/a
5 TRCN0000331082 CAACACCGTAACCGTTTGTAT pLKO_005 1325 3UTR 100% 5.625 7.875 N MBNL2 n/a
6 TRCN0000149998 CCAGCAGATGCAATTTATGTT pLKO.1 983 3UTR 100% 5.625 7.875 N MBNL2 n/a
7 TRCN0000353711 CCAGCAGATGCAATTTATGTT pLKO_005 983 3UTR 100% 5.625 7.875 N MBNL2 n/a
8 TRCN0000102455 GCCAATATAGATGACTGTATT pLKO.1 5187 3UTR 100% 13.200 10.560 N Mbnl2 n/a
9 TRCN0000102459 CAAAGAGACAAGCACTTGAAA pLKO.1 1525 3UTR 100% 5.625 3.938 N Mbnl2 n/a
10 TRCN0000102458 CGGCTATTAGCTTTGCTCCTT pLKO.1 1066 3UTR 100% 2.640 1.848 N Mbnl2 n/a
11 TRCN0000180132 CGGCTATTAGCTTTGCTCCTT pLKO.1 1066 3UTR 100% 2.640 1.848 N MBNL2 n/a
12 TRCN0000353712 CGGCTATTAGCTTTGCTCCTT pLKO_005 1066 3UTR 100% 2.640 1.848 N MBNL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02332 pDONR223 100% 16.5% None (many diffs) n/a
2 ccsbBroad304_02332 pLX_304 0% 16.5% V5 (many diffs) n/a
3 TRCN0000478908 AACCTATTACAGCCGGGGGGAGCC pLX_317 36% 16.5% V5 (many diffs) n/a
Download CSV