Transcript: Mouse XM_006519631.3

PREDICTED: Mus musculus sterile alpha motif domain containing 4 (Samd4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Samd4 (74480)
Length:
5647
CDS:
383..1291

Additional Resources:

NCBI RefSeq record:
XM_006519631.3
NBCI Gene record:
Samd4 (74480)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519631.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217513 GTCTTGTTCATGAGGCATTTA pLKO.1 717 CDS 100% 13.200 9.240 N Samd4 n/a
2 TRCN0000179422 CCTCCAGCAAACTTTCAGATA pLKO.1 1848 3UTR 100% 4.950 3.465 N Samd4 n/a
3 TRCN0000184529 GCAGAAGCTCTTTCGGTCTTT pLKO.1 781 CDS 100% 4.950 3.465 N Samd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519631.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15747 pDONR223 0% 78.8% 82% None (many diffs) n/a
2 ccsbBroad304_15747 pLX_304 0% 78.8% 82% V5 (many diffs) n/a
3 TRCN0000465896 TGGTACACAGTCATTTGCATACCT pLX_317 39.4% 78.8% 82% V5 (many diffs) n/a
4 ccsbBroadEn_07831 pDONR223 100% 43.2% 45% None (many diffs) n/a
5 ccsbBroad304_07831 pLX_304 0% 43.2% 45% V5 (many diffs) n/a
6 TRCN0000491644 TAACATCATGGATAGATATGTGGT pLX_317 18.5% 43.2% 45% V5 (many diffs) n/a
Download CSV