Transcript: Mouse XM_006521593.3

PREDICTED: Mus musculus RNA binding protein, fox-1 homolog (C. elegans) 2 (Rbfox2), transcript variant X29, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbfox2 (93686)
Length:
6534
CDS:
269..1372

Additional Resources:

NCBI RefSeq record:
XM_006521593.3
NBCI Gene record:
Rbfox2 (93686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521593.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074544 CGGGTTCGTAACTTTCGAGAA pLKO.1 727 CDS 100% 4.050 5.670 N RBFOX2 n/a
2 TRCN0000311693 CGGGTTCGTAACTTTCGAGAA pLKO_005 727 CDS 100% 4.050 5.670 N RBFOX2 n/a
3 TRCN0000102343 CGACTACATGTCTCTAATATT pLKO.1 605 CDS 100% 15.000 10.500 N Rbfox2 n/a
4 TRCN0000102340 GCCATTAAAGAGTGTGTAGAA pLKO.1 2419 3UTR 100% 4.950 3.465 N Rbfox2 n/a
5 TRCN0000102344 GCTGTGTATGGTCCTGAGTTA pLKO.1 902 CDS 100% 4.950 3.465 N Rbfox2 n/a
6 TRCN0000074543 CCTCACTATGTTCTTTGAATA pLKO.1 1495 3UTR 100% 13.200 7.920 N RBFOX2 n/a
7 TRCN0000306861 TTGGCGCTGTGGCGAGTTTAT pLKO_005 1307 CDS 100% 13.200 18.480 N RBFOX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521593.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02790 pDONR223 100% 88.4% 78.2% None (many diffs) n/a
2 ccsbBroad304_02790 pLX_304 0% 88.4% 78.2% V5 (many diffs) n/a
3 ccsbBroadEn_11745 pDONR223 100% 84.9% 74.6% None (many diffs) n/a
4 ccsbBroad304_11745 pLX_304 0% 84.9% 74.6% V5 (many diffs) n/a
5 TRCN0000478244 AAGGTTCGACCCGCACGGCTGATA pLX_317 24.7% 84.9% 74.6% V5 (many diffs) n/a
Download CSV