Construct: ORF TRCN0000478244
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005517.1_s317c1
- Derived from:
- ccsbBroadEn_11745
- DNA Barcode:
- AAGGTTCGACCCGCACGGCTGATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RBFOX2 (23543)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478244
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001082576.3 | 95.1% | 94.9% | 396_449del;995C>T |
2 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_017028696.1 | 94.8% | 94.6% | 252_254delGCA;399_452del;998C>T |
3 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001031695.4 | 94.1% | 93.6% | 396_449del;752_763del;1007C>T |
4 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349997.2 | 93.8% | 93.4% | (many diffs) |
5 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_024452191.1 | 93.3% | 92.8% | (many diffs) |
6 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349983.2 | 91.7% | 73.2% | (many diffs) |
7 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_017028693.1 | 91.4% | 73% | (many diffs) |
8 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349998.2 | 90.7% | 72.3% | (many diffs) |
9 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_017028698.1 | 90.7% | 74.6% | (many diffs) |
10 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_006724191.1 | 90.5% | 72.1% | (many diffs) |
11 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_014309.4 | 90.5% | 74.4% | (many diffs) |
12 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001082577.3 | 89.8% | 73.6% | (many diffs) |
13 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349990.2 | 89% | 87.9% | (many diffs) |
14 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349996.2 | 89% | 87.9% | (many diffs) |
15 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_006724192.2 | 88.8% | 70.2% | (many diffs) |
16 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_017028691.1 | 88.4% | 69.8% | (many diffs) |
17 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_017028690.1 | 88.2% | 69.7% | (many diffs) |
18 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349989.2 | 88.1% | 86.8% | (many diffs) |
19 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_024452192.1 | 86.5% | 68.4% | (many diffs) |
20 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349982.2 | 86% | 67.9% | (many diffs) |
21 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_006724194.2 | 85.7% | 67.5% | (many diffs) |
22 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_017028697.1 | 85.7% | 67.5% | (many diffs) |
23 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_017028686.1 | 85.5% | 68.1% | (many diffs) |
24 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_024452189.1 | 85.4% | 67.3% | (many diffs) |
25 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_024452190.1 | 85.4% | 67.3% | (many diffs) |
26 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349991.2 | 85.2% | 67.1% | (many diffs) |
27 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_006724189.3 | 84.9% | 66.9% | (many diffs) |
28 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349994.2 | 84.9% | 69% | (many diffs) |
29 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349992.2 | 84.1% | 68.1% | (many diffs) |
30 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349995.2 | 82.3% | 64.4% | (many diffs) |
31 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_024452188.1 | 79.8% | 63% | (many diffs) |
32 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_017028687.2 | 79.6% | 62.8% | (many diffs) |
33 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_005261432.2 | 79.4% | 78.4% | (many diffs) |
34 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001349999.1 | 79.3% | 78.2% | (many diffs) |
35 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001082579.2 | 78.7% | 77.5% | (many diffs) |
36 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | NM_001082578.3 | 78.5% | 77.3% | (many diffs) |
37 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_005261430.2 | 77.8% | 75.8% | (many diffs) |
38 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_006724187.2 | 77.1% | 75% | (many diffs) |
39 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_005261429.2 | 77% | 61.2% | (many diffs) |
40 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_005261428.2 | 76.8% | 61.1% | (many diffs) |
41 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_006724186.2 | 76.3% | 60.5% | (many diffs) |
42 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_006724185.2 | 76.2% | 60.4% | (many diffs) |
43 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_017028688.1 | 75.9% | 61.8% | (many diffs) |
44 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_005261433.2 | 75.7% | 61.6% | (many diffs) |
45 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_006724188.2 | 75% | 60.9% | (many diffs) |
46 | human | 23543 | RBFOX2 | RNA binding fox-1 homolog 2 | XM_006724193.3 | 64.1% | 62.5% | (many diffs) |
47 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | NM_001110830.2 | 89.2% | 93.6% | (many diffs) |
48 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | NM_001110828.2 | 88.2% | 92.3% | (many diffs) |
49 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | NM_001110829.2 | 87.4% | 90.7% | (many diffs) |
50 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | NM_001286419.1 | 85.4% | 88% | (many diffs) |
51 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521593.3 | 84.9% | 74.6% | (many diffs) |
52 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_017316812.1 | 83.1% | 86.7% | (many diffs) |
53 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | NM_001286417.1 | 81.8% | 75.9% | (many diffs) |
54 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521598.2 | 75% | 79.8% | (many diffs) |
55 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521577.2 | 74.7% | 77.9% | (many diffs) |
56 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | NM_001110827.2 | 74.5% | 77.7% | (many diffs) |
57 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521586.3 | 74.2% | 67.9% | (many diffs) |
58 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | NM_053104.6 | 73.8% | 76.8% | (many diffs) |
59 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521584.3 | 73.7% | 67.2% | (many diffs) |
60 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521583.3 | 73.5% | 67.1% | (many diffs) |
61 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521576.2 | 73.1% | 75.3% | (many diffs) |
62 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521574.2 | 72.4% | 74.4% | (many diffs) |
63 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521570.2 | 72.4% | 61.4% | (many diffs) |
64 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_017316809.1 | 72.2% | 61.2% | (many diffs) |
65 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521585.3 | 72.1% | 65.3% | (many diffs) |
66 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | NM_001286418.1 | 72% | 75.4% | (many diffs) |
67 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521569.2 | 71.6% | 60.5% | (many diffs) |
68 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_017316811.1 | 71.2% | 64.5% | (many diffs) |
69 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521582.3 | 71.2% | 64.6% | (many diffs) |
70 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | NM_175387.3 | 71% | 61.8% | (many diffs) |
71 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521587.2 | 70.9% | 72.3% | (many diffs) |
72 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_017316810.1 | 70.9% | 64.3% | (many diffs) |
73 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521599.2 | 70.5% | 61.2% | (many diffs) |
74 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521580.2 | 70.4% | 61.1% | (many diffs) |
75 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521568.2 | 70.3% | 58.1% | (many diffs) |
76 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521579.3 | 69.1% | 62.5% | (many diffs) |
77 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521588.3 | 69% | 62.5% | (many diffs) |
78 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521578.3 | 68.9% | 62.4% | (many diffs) |
79 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521567.3 | 63.4% | 58.7% | (many diffs) |
80 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521566.3 | 63.1% | 57.4% | (many diffs) |
81 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521565.3 | 62.7% | 56.8% | (many diffs) |
82 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521564.3 | 62.6% | 56.7% | (many diffs) |
83 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521571.3 | 60.2% | 53.3% | (many diffs) |
84 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521592.2 | 58% | 58.3% | (many diffs) |
85 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521596.3 | 32.4% | 29.7% | (many diffs) |
86 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XM_006521597.3 | 31.9% | 29.7% | (many diffs) |
87 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XR_384057.2 | 14% | (many diffs) | |
88 | mouse | 93686 | Rbfox2 | RNA binding protein, fox-1 ... | XR_001781584.1 | 14% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1140
- ORF length:
- 1074
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gaaaaagaaa atggtaactc agggtaacca ggagccgaca acaactcctg 121 acgcaatggt tcagcctttt actaccatcc catttccacc acctccgcag aatggaattc 181 ccacagagta tggggtgcca cacactcaag actatgccgg ccagaccggt gagcataacc 241 tgacactcta cggaagtacg caagcccacg gggagcagag cagcaactca cccagcacac 301 aaaatggatc tcttacgaca gaaggtggag cacagacaga cggccagcag tcacagacac 361 aaagtagtga aaattcagag agtaaatcta ccccgaaacg gctgcatgtc tctaatattc 421 ctttccgctt ccgggaccct gacctccggc agatgtttgg gggattcggg ttcgtaactt 481 tcgagaatag tgctgatgca gacagggcca gggagaaatt acacggcacc gtggtagagg 541 gccgtaaaat cgaggtgaat aatgctacag cacgtgtaat gaccaataag aagatggtca 601 caccatatgc aaatggttgg aaattaagcc cagtagttgg agctgtatat ggtccggagt 661 tatatgcagc atccagcttt caagcagatg tgtccctagg caatgatgca gcagtgcccc 721 tatcaggaag agggggtatc aacacttaca ttcctttaat cattcctggc ttcccttacc 781 ctactgcagc caccacggca gccgctttca gaggagccca tttgaggggc agagggcgga 841 cagtatatgg tgcagtccga gcggtacctc caacagccaT CCCCGCCTAT CCAGGTGTGG 901 TTTACCAGGA CGGATTTTAC GGTGCTGACC TCTATGGTGG ATATGCAGCC TACAGATATG 961 CACAGCCTGC TACTGCAACC GCAGCCACCG CTGCTGCAGC CGCTGTAGCC GCTTACAGTG 1021 ACGGTTATGG CAGGGTGTAC ACAGCCGACC CCTACCATGC CCTTGCCCCT GCCGCTAGCT 1081 ATGGAGTTGG CGCTGTGGCG AGTTTATACC GAGGTGGCTA CAGCCGATTT GCCCCCTACT 1141 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1201 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1261 TTTATATATC TTGTGGAAAG GACGAAAGGT TCGACCCGCA CGGCTGATAA CGCGTTAAGT 1321 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt