Transcript: Mouse XM_011238603.2

PREDICTED: Mus musculus transforming growth factor, beta receptor associated protein 1 (Tgfbrap1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tgfbrap1 (73122)
Length:
5668
CDS:
671..3277

Additional Resources:

NCBI RefSeq record:
XM_011238603.2
NBCI Gene record:
Tgfbrap1 (73122)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238603.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027756 CGCAGGACTGTCCAAATGTTT pLKO.1 1127 CDS 100% 5.625 4.500 N Tgfbrap1 n/a
2 TRCN0000027763 TGAACCATCATGCCAGGGAAT pLKO.1 2916 CDS 100% 4.050 3.240 N Tgfbrap1 n/a
3 TRCN0000027709 CAACTCTATAACCCTGGTTAA pLKO.1 982 CDS 100% 10.800 7.560 N Tgfbrap1 n/a
4 TRCN0000027745 GTCCACTTGTTGAAAGAGAAA pLKO.1 2651 CDS 100% 4.950 3.465 N Tgfbrap1 n/a
5 TRCN0000027727 GAAGAGTGATTGTTGCCACAA pLKO.1 1578 CDS 100% 4.050 2.835 N Tgfbrap1 n/a
6 TRCN0000005764 CGGAGGAACATTCCAAAGGAA pLKO.1 1703 CDS 100% 3.000 2.100 N TGFBRAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238603.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07408 pDONR223 100% 85.2% 88.4% None (many diffs) n/a
2 ccsbBroad304_07408 pLX_304 0% 85.2% 88.4% V5 (many diffs) n/a
3 TRCN0000466541 ACCCTTTCAGGCTTCGACCGAGTT pLX_317 12.2% 85.2% 88.4% V5 (many diffs) n/a
Download CSV