Transcript: Mouse XM_017318427.1

PREDICTED: Mus musculus phosphorylase kinase alpha 1 (Phka1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phka1 (18679)
Length:
8305
CDS:
363..2783

Additional Resources:

NCBI RefSeq record:
XM_017318427.1
NBCI Gene record:
Phka1 (18679)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321941 TCGTATTCTCAGCCATATTTA pLKO_005 1790 CDS 100% 15.000 21.000 N Phka1 n/a
2 TRCN0000025069 GCTCGTATTCTCAGCCATATT pLKO.1 1788 CDS 100% 13.200 18.480 N Phka1 n/a
3 TRCN0000025072 CCCGTTATTTAGACCGCCTTT pLKO.1 2347 CDS 100% 4.050 5.670 N Phka1 n/a
4 TRCN0000199049 CCAGCTGAGCTGAAGCTATTT pLKO.1 1305 CDS 100% 13.200 9.240 N PHKA1 n/a
5 TRCN0000342702 CCAGCTGAGCTGAAGCTATTT pLKO_005 1305 CDS 100% 13.200 9.240 N PHKA1 n/a
6 TRCN0000025071 GCCATTGTTCTGGACATACTT pLKO.1 1346 CDS 100% 5.625 3.938 N Phka1 n/a
7 TRCN0000322011 GCCATTGTTCTGGACATACTT pLKO_005 1346 CDS 100% 5.625 3.938 N Phka1 n/a
8 TRCN0000006189 CCACAGTTTATAGACCAGCAA pLKO.1 1926 CDS 100% 2.640 1.848 N PHKA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14751 pDONR223 44.5% 60.5% 31.3% None (many diffs) n/a
2 ccsbBroad304_14751 pLX_304 0% 60.5% 31.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468045 TGTTCTGACCCCTTACGGAGCCAC pLX_317 8.8% 60.5% 31.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV