Transcript: Mouse XM_006522446.3

PREDICTED: Mus musculus peptidylprolyl isomerase (cyclophilin)-like 2 (Ppil2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppil2 (66053)
Length:
2111
CDS:
396..1427

Additional Resources:

NCBI RefSeq record:
XM_006522446.3
NBCI Gene record:
Ppil2 (66053)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101361 GCCAAACAAGACCCATCTTAT pLKO.1 426 CDS 100% 13.200 9.240 N Ppil2 n/a
2 TRCN0000101364 CTTACCTGGATAAGAAGCATA pLKO.1 1024 CDS 100% 4.950 3.465 N Ppil2 n/a
3 TRCN0000101360 GACAGTAAAGACACTTGGATT pLKO.1 1914 3UTR 100% 4.950 3.465 N Ppil2 n/a
4 TRCN0000101362 GCAGCTAAACATCAAGGCCAA pLKO.1 257 5UTR 100% 2.160 1.512 N Ppil2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07930 pDONR223 100% 56.3% 59.1% None (many diffs) n/a
2 ccsbBroad304_07930 pLX_304 0% 56.3% 59.1% V5 (many diffs) n/a
3 TRCN0000474568 TGAGGTCCAGAGTGGGCCCGGCAC pLX_317 27.2% 56.3% 59.1% V5 (many diffs) n/a
4 ccsbBroadEn_07929 pDONR223 100% 55.4% 54.6% None (many diffs) n/a
5 ccsbBroad304_07929 pLX_304 0% 55.4% 54.6% V5 (many diffs) n/a
6 TRCN0000469418 ATTAATCTTAGCCAAAAATGCGCA pLX_317 28.2% 55.4% 54.6% V5 (many diffs) n/a
Download CSV