Transcript: Mouse XM_006538504.3

PREDICTED: Mus musculus capping protein (actin filament) muscle Z-line, beta (Capzb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Capzb (12345)
Length:
1723
CDS:
130..1050

Additional Resources:

NCBI RefSeq record:
XM_006538504.3
NBCI Gene record:
Capzb (12345)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538504.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305997 TATAGGTCACCGTGGAGTAAC pLKO_005 427 CDS 100% 10.800 15.120 N Capzb n/a
2 TRCN0000091883 CACGCCATGCACTCGTTAGGT pLKO.1 1174 3UTR 100% 1.000 1.400 N Capzb n/a
3 TRCN0000325512 CACGCCATGCACTCGTTAGGT pLKO_005 1174 3UTR 100% 1.000 1.400 N Capzb n/a
4 TRCN0000305932 ATGGATCCAAGAAGATCAAAG pLKO_005 632 CDS 100% 10.800 7.560 N Capzb n/a
5 TRCN0000091884 GCAGACAAATCAAAGCAAGAA pLKO.1 1077 3UTR 100% 4.950 3.465 N Capzb n/a
6 TRCN0000325587 GCAGACAAATCAAAGCAAGAA pLKO_005 1077 3UTR 100% 4.950 3.465 N Capzb n/a
7 TRCN0000091886 GTGCAGACGTTTGCAGACAAA pLKO.1 1065 3UTR 100% 4.950 3.465 N Capzb n/a
8 TRCN0000325511 GTGCAGACGTTTGCAGACAAA pLKO_005 1065 3UTR 100% 4.950 3.465 N Capzb n/a
9 TRCN0000091885 CGGCTCAGAAAGCTGGAGGTA pLKO.1 490 CDS 100% 0.880 0.616 N Capzb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538504.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00218 pDONR223 100% 78.3% 81.6% None (many diffs) n/a
2 ccsbBroad304_00218 pLX_304 0% 78.3% 81.6% V5 (many diffs) n/a
3 TRCN0000472378 GTTACTGCGCTTCTCCCTAGTCGT pLX_317 55.5% 78.3% 81.6% V5 (many diffs) n/a
Download CSV