Transcript: Mouse XM_006520928.3

PREDICTED: Mus musculus zinc finger protein 647 (Zfp647), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp647 (239546)
Length:
2465
CDS:
404..2011

Additional Resources:

NCBI RefSeq record:
XM_006520928.3
NBCI Gene record:
Zfp647 (239546)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520928.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085760 CCACCATTAATCTCAGACGAA pLKO.1 731 CDS 100% 2.640 3.696 N Zfp647 n/a
2 TRCN0000085758 CCGCACTTAGAACATGCACAA pLKO.1 2030 3UTR 100% 4.050 3.240 N Zfp647 n/a
3 TRCN0000017845 CAGCCTGAAAGCAACTCTGAT pLKO.1 1792 CDS 100% 4.950 3.465 N ZNF250 n/a
4 TRCN0000085762 CAGACTTGAATGTGCCACCAT pLKO.1 717 CDS 100% 2.640 1.848 N Zfp647 n/a
5 TRCN0000085761 CCTGATGAATCACGAGAGGAT pLKO.1 1555 CDS 100% 2.640 1.848 N Zfp647 n/a
6 TRCN0000434057 GAGAAGCCCTACGAGTGTAAC pLKO_005 1082 CDS 100% 10.800 5.400 Y Zfp647 n/a
7 TRCN0000427014 ACCGGAGAGAAACCCTATGAG pLKO_005 1916 CDS 100% 4.950 2.475 Y Zfp647 n/a
8 TRCN0000426145 CAGAGTGTGGCAAAGCCTTCA pLKO_005 1773 CDS 100% 4.050 2.025 Y Zfp647 n/a
9 TRCN0000226240 GAGAAGCCCTACGAGTGTAAT pLKO_005 1082 CDS 100% 13.200 6.600 Y LOC676710 n/a
10 TRCN0000086605 CCGGAGAGAAACCCTATGAAT pLKO.1 1917 CDS 100% 5.625 2.813 Y Zfp933 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520928.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12415 pDONR223 100% 72.8% 76.2% None (many diffs) n/a
2 ccsbBroad304_12415 pLX_304 0% 72.8% 76.2% V5 (many diffs) n/a
3 TRCN0000481370 TGAACCCTTGAATGACGCTTCCCC pLX_317 31% 72.8% 76.2% V5 (many diffs) n/a
Download CSV