Transcript: Mouse XR_382743.3

PREDICTED: Mus musculus excision repaiross-complementing rodent repair deficiency, complementation group 8 (Ercc8), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ercc8 (71991)
Length:
5248
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_382743.3
NBCI Gene record:
Ercc8 (71991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_382743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249433 GGGTTAACACCCTCGACATTG pLKO_005 216 3UTR 100% 10.800 15.120 N Ercc8 n/a
2 TRCN0000249434 TTGCAACAGTGGCATCATAAT pLKO_005 1805 3UTR 100% 13.200 10.560 N Ercc8 n/a
3 TRCN0000249432 ACAACACCCTGGTGAACTATG pLKO_005 915 3UTR 100% 10.800 8.640 N Ercc8 n/a
4 TRCN0000257859 CTGTGTGTTCCAGCCTAATTT pLKO_005 1016 3UTR 100% 15.000 10.500 N Ercc8 n/a
5 TRCN0000217072 CACATCCAGCTCATTTGATAA pLKO.1 427 3UTR 100% 13.200 9.240 N Ercc8 n/a
6 TRCN0000257876 CGCCATGCTCAAGGGACATTA pLKO_005 980 3UTR 100% 13.200 9.240 N Ercc8 n/a
7 TRCN0000175788 GAGTTAAACAAAGACAGGGAT pLKO.1 173 3UTR 100% 2.640 1.848 N Ercc8 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3682 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_382743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10735 pDONR223 100% 10.1% None (many diffs) n/a
2 ccsbBroad304_10735 pLX_304 0% 10.1% V5 (many diffs) n/a
3 TRCN0000470233 TGCAGCCACTTTTTTAGGCACCTT pLX_317 73% 10.1% V5 (many diffs) n/a
Download CSV