Transcript: Mouse XR_384604.3

PREDICTED: Mus musculus protein disulfide isomerase associated 5 (Pdia5), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pdia5 (72599)
Length:
1703
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_384604.3
NBCI Gene record:
Pdia5 (72599)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_384604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111793 CCCACACTGTAAGAAGGTCAT pLKO.1 1271 3UTR 100% 4.050 5.670 N Pdia5 n/a
2 TRCN0000332799 CCCACACTGTAAGAAGGTCAT pLKO_005 1271 3UTR 100% 4.050 5.670 N Pdia5 n/a
3 TRCN0000111791 CAAGAGAATCATGCCACATTT pLKO.1 685 3UTR 100% 13.200 9.240 N Pdia5 n/a
4 TRCN0000332796 CAAGAGAATCATGCCACATTT pLKO_005 685 3UTR 100% 13.200 9.240 N Pdia5 n/a
5 TRCN0000111794 GCTACCCTACCATCTGCTATT pLKO.1 807 3UTR 100% 10.800 7.560 N Pdia5 n/a
6 TRCN0000332797 GCTACCCTACCATCTGCTATT pLKO_005 807 3UTR 100% 10.800 7.560 N Pdia5 n/a
7 TRCN0000111790 CCCATCAGAGTTCGAGAACAT pLKO.1 763 3UTR 100% 4.950 3.465 N Pdia5 n/a
8 TRCN0000332798 CCCATCAGAGTTCGAGAACAT pLKO_005 763 3UTR 100% 4.950 3.465 N Pdia5 n/a
9 TRCN0000111792 CGACCCTAAGGACTTGAAGAA pLKO.1 232 3UTR 100% 4.950 3.465 N Pdia5 n/a
10 TRCN0000049401 CCACACTGTAAGAAGGTCATT pLKO.1 1272 3UTR 100% 4.950 3.465 N PDIA5 n/a
11 TRCN0000292045 CCACACTGTAAGAAGGTCATT pLKO_005 1272 3UTR 100% 4.950 3.465 N PDIA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_384604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10232 pDONR223 100% 39.5% None (many diffs) n/a
2 ccsbBroad304_10232 pLX_304 0% 39.5% V5 (many diffs) n/a
3 TRCN0000471423 ACCATCTTTTCTAAATGGATCATG pLX_317 43.7% 39.5% V5 (many diffs) n/a
Download CSV