Transcript: Mouse XM_006522175.3

PREDICTED: Mus musculus RNA binding protein, fox-1 homolog (C. elegans) 1 (Rbfox1), transcript variant X19, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbfox1 (268859)
Length:
2406
CDS:
561..1904

Additional Resources:

NCBI RefSeq record:
XM_006522175.3
NBCI Gene record:
Rbfox1 (268859)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522175.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336321 AGCACGCGTGATGACAAATAA pLKO_005 1205 CDS 100% 15.000 21.000 N Rbfox1 n/a
2 TRCN0000097931 CCGACAAATGTTTGGTCAATT pLKO.1 1028 CDS 100% 13.200 9.240 N Rbfox1 n/a
3 TRCN0000353387 GGATCCAGACCTCCGACAAAT pLKO_005 1016 CDS 100% 13.200 9.240 N Rbfox1 n/a
4 TRCN0000097932 CCCAGACACAACCTTCTGAAA pLKO.1 934 CDS 100% 4.950 3.465 N Rbfox1 n/a
5 TRCN0000097934 GCATGTGTCCAACATCCCTTT pLKO.1 986 CDS 100% 4.050 2.835 N Rbfox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522175.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03449 pDONR223 100% 78.5% 81.5% None (many diffs) n/a
2 ccsbBroad304_03449 pLX_304 0% 78.5% 81.5% V5 (many diffs) n/a
3 TRCN0000466913 CTCAGGTTCATGAAGTTACTCGTT pLX_317 21.6% 78.5% 81.5% V5 (many diffs) n/a
Download CSV