Transcript: Mouse XM_017314968.1

PREDICTED: Mus musculus Max protein (Max), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Max (17187)
Length:
1939
CDS:
331..642

Additional Resources:

NCBI RefSeq record:
XM_017314968.1
NBCI Gene record:
Max (17187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304477 ACGTAGGGACCACATCAAAGA pLKO_005 176 5UTR 100% 4.950 6.930 N Max n/a
2 TRCN0000042713 GCTCACCATAATGCACTGGAA pLKO.1 150 5UTR 100% 2.640 3.696 N Max n/a
3 TRCN0000042714 GCAACAGAGTATATCCAGTAT pLKO.1 273 5UTR 100% 4.950 3.960 N Max n/a
4 TRCN0000315984 GCAACAGAGTATATCCAGTAT pLKO_005 273 5UTR 100% 4.950 3.960 N Max n/a
5 TRCN0000304478 CCCTCCTTTGTAAGGATTATT pLKO_005 1113 3UTR 100% 15.000 10.500 N Max n/a
6 TRCN0000374152 ACCATTGAGAAGACTCTTTAT pLKO_005 722 3UTR 100% 13.200 9.240 N Max n/a
7 TRCN0000042717 CACTGGAGAAGGCAAGATCAA pLKO.1 461 CDS 100% 4.950 3.465 N Max n/a
8 TRCN0000374209 TGCCCAACTGCAGACCAACTA pLKO_005 483 CDS 100% 4.950 3.465 N Max n/a
9 TRCN0000042715 CCCAAATCCTAGACAAAGCAA pLKO.1 256 5UTR 100% 3.000 2.100 N Max n/a
10 TRCN0000316020 CCCAAATCCTAGACAAAGCAA pLKO_005 256 5UTR 100% 3.000 2.100 N Max n/a
11 TRCN0000039867 GACCACATCAAAGACAGCTTT pLKO.1 183 5UTR 100% 4.950 2.970 N MAX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15495 pDONR223 0% 39.4% 41.1% None (many diffs) n/a
2 ccsbBroad304_15495 pLX_304 0% 39.4% 41.1% V5 (many diffs) n/a
3 TRCN0000468720 GTCTTCCACGTTCCTTTAATGCAG pLX_317 73.3% 39.4% 41.1% V5 (many diffs) n/a
4 ccsbBroadEn_15494 pDONR223 0% 39.2% 40.5% None (many diffs) n/a
5 ccsbBroad304_15494 pLX_304 0% 39.2% 40.5% V5 (many diffs) n/a
6 TRCN0000469052 TCAGTACTAGGAAGGTCTCTACGA pLX_317 74.2% 39.2% 40.5% V5 (many diffs) n/a
7 ccsbBroadEn_00978 pDONR223 100% 37.5% 38.9% None (many diffs) n/a
8 ccsbBroad304_00978 pLX_304 0% 37.5% 38.9% V5 (many diffs) n/a
9 TRCN0000467427 CCTTCTTCGGGGACGGAAGTTACA pLX_317 69.4% 37.5% 38.9% V5 (many diffs) n/a
Download CSV