Transcript: Mouse XR_001782069.1

PREDICTED: Mus musculus ubiquitin protein ligase E3 component n-recognin 2 (Ubr2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubr2 (224826)
Length:
2836
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782069.1
NBCI Gene record:
Ubr2 (224826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782069.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194410 CCACCCATGTTGATAGAACAT pLKO.1 2489 3UTR 100% 0.495 0.396 N Ubr2 n/a
2 TRCN0000194150 GCAGGTTTGCATGTATTGTTA pLKO.1 2411 3UTR 100% 5.625 3.938 N Ubr2 n/a
3 TRCN0000298120 GCAGGTTTGCATGTATTGTTA pLKO_005 2411 3UTR 100% 5.625 3.938 N Ubr2 n/a
4 TRCN0000194475 GCAACTACAGTTGATCGAGAT pLKO.1 1337 3UTR 100% 4.050 2.835 N Ubr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782069.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07865 pDONR223 100% 40.2% None (many diffs) n/a
2 ccsbBroad304_07865 pLX_304 0% 40.2% V5 (many diffs) n/a
3 TRCN0000475456 GTACCCCTTTTGGGTAAATGACCA pLX_317 44.4% 40.2% V5 (many diffs) n/a
Download CSV