Transcript: Mouse XR_001784631.1

PREDICTED: Mus musculus glomulin, FKBP associated protein (Glmn), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Glmn (170823)
Length:
1624
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784631.1
NBCI Gene record:
Glmn (170823)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012866 CCGTTGGACTAGCATTGTCAA pLKO.1 559 3UTR 100% 4.950 6.930 N Glmn n/a
2 TRCN0000337466 CCGTTGGACTAGCATTGTCAA pLKO_005 559 3UTR 100% 4.950 6.930 N Glmn n/a
3 TRCN0000012864 GCCTTGATAGAGTTCACGAAA pLKO.1 669 3UTR 100% 4.950 3.960 N Glmn n/a
4 TRCN0000373988 AGTTGAACATGGAGCATATTG pLKO_005 1072 3UTR 100% 13.200 9.240 N Glmn n/a
5 TRCN0000011034 CCCTTTGCTGACAGCACAATT pLKO.1 785 3UTR 100% 13.200 9.240 N GLMN n/a
6 TRCN0000337525 CCCTTTGCTGACAGCACAATT pLKO_005 785 3UTR 100% 13.200 9.240 N Glmn n/a
7 TRCN0000342547 CCCTTTGCTGACAGCACAATT pLKO_005 785 3UTR 100% 13.200 9.240 N GLMN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02629 pDONR223 100% 67.1% None (many diffs) n/a
2 ccsbBroad304_02629 pLX_304 0% 67.1% V5 (many diffs) n/a
3 TRCN0000478105 CCCAGTGCAAACAATACCGTTGCG pLX_317 21.8% 67.1% V5 (many diffs) n/a
Download CSV