Transcript: Human NR_147854.1

Homo sapiens neurotrimin (NTM), transcript variant 20, non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
NTM (50863)
Length:
3142
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147854.1
NBCI Gene record:
NTM (50863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113596 CGTGAACTATCCACCATACAT pLKO.1 1085 3UTR 100% 5.625 7.875 N Ntm n/a
2 TRCN0000161782 CGTGAACTATCCACCATACAT pLKO.1 1085 3UTR 100% 5.625 7.875 N NTM n/a
3 TRCN0000165957 GCGTGTGTTGTGAAACGTGAA pLKO.1 1937 3UTR 100% 4.050 5.670 N NTM n/a
4 TRCN0000429022 AGCAACCAATCAGATATATAC pLKO_005 1543 3UTR 100% 13.200 9.240 N NTM n/a
5 TRCN0000420978 CATTAATGAAGGGAACAATAT pLKO_005 869 3UTR 100% 13.200 9.240 N NTM n/a
6 TRCN0000162385 CCACTTGCTTTAGCCCATTAT pLKO.1 2856 3UTR 100% 13.200 9.240 N NTM n/a
7 TRCN0000159423 GTGAAGACGAATACTTGGAAA pLKO.1 973 3UTR 100% 4.950 3.465 N NTM n/a
8 TRCN0000162384 CAGTGGTACAAGGATGACAAA pLKO.1 1191 3UTR 100% 4.950 2.475 Y NTM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08191 pDONR223 100% 20.9% None (many diffs) n/a
2 ccsbBroad304_08191 pLX_304 0% 20.9% V5 (many diffs) n/a
3 TRCN0000467633 TGAACTCCATTTGGGGCGGGAACC pLX_317 41.5% 20.9% V5 (many diffs) n/a
Download CSV