Transcript: Human XM_024452191.1

PREDICTED: Homo sapiens RNA binding fox-1 homolog 2 (RBFOX2), transcript variant X26, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBFOX2 (23543)
Length:
6801
CDS:
214..1332

Additional Resources:

NCBI RefSeq record:
XM_024452191.1
NBCI Gene record:
RBFOX2 (23543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452191.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294132 AGACATTAGGAGCCGATAAAT pLKO_005 1684 3UTR 100% 15.000 21.000 N RBFOX2 n/a
2 TRCN0000294044 GTATATGGTCCGGAGTTATAT pLKO_005 835 CDS 100% 15.000 21.000 N RBFOX2 n/a
3 TRCN0000306861 TTGGCGCTGTGGCGAGTTTAT pLKO_005 1277 CDS 100% 13.200 18.480 N RBFOX2 n/a
4 TRCN0000294042 GCCGCTTACAGTGACGGTTAT pLKO_005 1198 CDS 100% 10.800 15.120 N RBFOX2 n/a
5 TRCN0000074544 CGGGTTCGTAACTTTCGAGAA pLKO.1 657 CDS 100% 4.050 5.670 N RBFOX2 n/a
6 TRCN0000311693 CGGGTTCGTAACTTTCGAGAA pLKO_005 657 CDS 100% 4.050 5.670 N RBFOX2 n/a
7 TRCN0000074545 GCATCCAGCTTTCAAGCAGAT pLKO.1 859 CDS 100% 4.050 2.835 N RBFOX2 n/a
8 TRCN0000074546 CATATGCAAATGGTTGGAAAT pLKO.1 794 CDS 100% 0.000 0.000 N RBFOX2 n/a
9 TRCN0000074547 CCATATGCAAATGGTTGGAAA pLKO.1 793 CDS 100% 0.000 0.000 N RBFOX2 n/a
10 TRCN0000074543 CCTCACTATGTTCTTTGAATA pLKO.1 1489 3UTR 100% 13.200 7.920 N RBFOX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452191.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02790 pDONR223 100% 97.2% 96.5% None (many diffs) n/a
2 ccsbBroad304_02790 pLX_304 0% 97.2% 96.5% V5 (many diffs) n/a
3 ccsbBroadEn_11745 pDONR223 100% 93.3% 92.8% None (many diffs) n/a
4 ccsbBroad304_11745 pLX_304 0% 93.3% 92.8% V5 (many diffs) n/a
5 TRCN0000478244 AAGGTTCGACCCGCACGGCTGATA pLX_317 24.7% 93.3% 92.8% V5 (many diffs) n/a
Download CSV