Transcript: Human NM_004671.5

Homo sapiens protein inhibitor of activated STAT 2 (PIAS2), transcript variant beta, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PIAS2 (9063)
Length:
11243
CDS:
163..2028

Additional Resources:

NCBI RefSeq record:
NM_004671.5
NBCI Gene record:
PIAS2 (9063)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004671.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230129 CATTCCACCATACGCCAATAT pLKO_005 1766 CDS 100% 13.200 18.480 N PIAS2 n/a
2 TRCN0000013352 CGAGTTTAGTTCAAAGCAGTA pLKO.1 653 CDS 100% 4.050 5.670 N PIAS2 n/a
3 TRCN0000013349 CCACAATCAAATCATCGGTTT pLKO.1 389 CDS 100% 4.050 3.240 N PIAS2 n/a
4 TRCN0000230128 ATCATTCCAGAGCACTAATTA pLKO_005 1112 CDS 100% 15.000 10.500 N PIAS2 n/a
5 TRCN0000428983 ATCATTCCAGAGCACTAATTA pLKO_005 1112 CDS 100% 15.000 10.500 N Pias2 n/a
6 TRCN0000422690 CTTACATCAGCCATGTTATTA pLKO_005 1057 CDS 100% 15.000 10.500 N Pias2 n/a
7 TRCN0000230127 GGCTTTGCTGGACGGAATAAA pLKO_005 232 CDS 100% 15.000 10.500 N PIAS2 n/a
8 TRCN0000431539 CTCATCAAGCCCACGAGTTTA pLKO_005 640 CDS 100% 13.200 9.240 N Pias2 n/a
9 TRCN0000013348 GCCATGTTATTACAGAGATTA pLKO.1 1066 CDS 100% 13.200 9.240 N PIAS2 n/a
10 TRCN0000013351 GCTGCTATTCCGCCTTCATTA pLKO.1 1729 CDS 100% 13.200 9.240 N PIAS2 n/a
11 TRCN0000435253 GCCCTCAAGAAGATAACTATC pLKO_005 821 CDS 100% 10.800 7.560 N Pias2 n/a
12 TRCN0000013350 GCAAGCAAGAAGAAAGTAGAT pLKO.1 1546 CDS 100% 4.950 3.465 N PIAS2 n/a
13 TRCN0000218049 ACTTGATTCTGGGAATCATTC pLKO_005 2039 3UTR 100% 1.080 0.756 N PIAS2 n/a
14 TRCN0000218814 AGACTGCAACAAGAACCAAAT pLKO_005 2182 3UTR 100% 10.800 6.480 N PIAS2 n/a
15 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6784 3UTR 100% 4.950 2.475 Y ERAP2 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6785 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 6956 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004671.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07353 pDONR223 100% 88.3% 88.8% None (many diffs) n/a
2 ccsbBroad304_07353 pLX_304 0% 88.3% 88.8% V5 (many diffs) n/a
3 TRCN0000477220 TCTAACTGATGACGTACAGTGCGC pLX_317 23.2% 88.3% 88.8% V5 (many diffs) n/a
Download CSV