Transcript: Human XR_002956409.1

PREDICTED: Homo sapiens leucine rich repeats and guanylate kinase domain containing (LRGUK), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRGUK (136332)
Length:
1945
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956409.1
NBCI Gene record:
LRGUK (136332)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956409.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359359 CAATAAGATCACGACAATTAA pLKO_005 754 3UTR 100% 15.000 21.000 N LRGUK n/a
2 TRCN0000152956 GCGTATCATGCTCTCACTAAA pLKO.1 653 3UTR 100% 13.200 18.480 N LRGUK n/a
3 TRCN0000151927 CCAACAATAAGATCACGACAA pLKO.1 750 3UTR 100% 4.050 5.670 N LRGUK n/a
4 TRCN0000158234 CCATGTTGTCAACAGCGTGAT pLKO.1 1186 3UTR 100% 4.050 5.670 N LRGUK n/a
5 TRCN0000359288 TTGGATCTTTCAGCGAATAAA pLKO_005 476 3UTR 100% 15.000 10.500 N LRGUK n/a
6 TRCN0000359360 GGATCGAGTTGATTATCATTT pLKO_005 1390 3UTR 100% 13.200 9.240 N LRGUK n/a
7 TRCN0000157299 CGTTACAGTTTCGCGCAGAAA pLKO.1 102 3UTR 100% 4.950 3.465 N LRGUK n/a
8 TRCN0000157300 CTGCCAAGAGTTTGGCTACAA pLKO.1 1820 3UTR 100% 0.495 0.347 N LRGUK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956409.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14383 pDONR223 100% 75.4% None (many diffs) n/a
2 ccsbBroad304_14383 pLX_304 0% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481604 ACTACGGAAGCCATTACGAGATAC pLX_317 20.1% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15247 pDONR223 64.4% 74.7% None (many diffs) n/a
5 ccsbBroad304_15247 pLX_304 0% 74.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000474481 AATGAAAAATACAGCGTGCCCAAT pLX_317 16.1% 74.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV