Transcript: Human NM_144648.3

Homo sapiens leucine rich repeats and guanylate kinase domain containing (LRGUK), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
LRGUK (136332)
Length:
3126
CDS:
29..2506

Additional Resources:

NCBI RefSeq record:
NM_144648.3
NBCI Gene record:
LRGUK (136332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144648.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359359 CAATAAGATCACGACAATTAA pLKO_005 766 CDS 100% 15.000 21.000 N LRGUK n/a
2 TRCN0000151044 GCGCATCCTACAAAGTATATT pLKO.1 1901 CDS 100% 15.000 21.000 N LRGUK n/a
3 TRCN0000152956 GCGTATCATGCTCTCACTAAA pLKO.1 665 CDS 100% 13.200 18.480 N LRGUK n/a
4 TRCN0000151927 CCAACAATAAGATCACGACAA pLKO.1 762 CDS 100% 4.050 5.670 N LRGUK n/a
5 TRCN0000158234 CCATGTTGTCAACAGCGTGAT pLKO.1 1198 CDS 100% 4.050 5.670 N LRGUK n/a
6 TRCN0000153391 GCACTTGATGTCTGATCCTAA pLKO.1 2511 3UTR 100% 4.950 3.960 N LRGUK n/a
7 TRCN0000359288 TTGGATCTTTCAGCGAATAAA pLKO_005 488 CDS 100% 15.000 10.500 N LRGUK n/a
8 TRCN0000153969 CCAGCGGAAAGAGATTCTATA pLKO.1 2006 CDS 100% 13.200 9.240 N LRGUK n/a
9 TRCN0000359360 GGATCGAGTTGATTATCATTT pLKO_005 1402 CDS 100% 13.200 9.240 N LRGUK n/a
10 TRCN0000157299 CGTTACAGTTTCGCGCAGAAA pLKO.1 114 CDS 100% 4.950 3.465 N LRGUK n/a
11 TRCN0000157300 CTGCCAAGAGTTTGGCTACAA pLKO.1 1845 CDS 100% 0.495 0.347 N LRGUK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144648.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14383 pDONR223 100% 99.8% 1.9% None 16_17insG;1236C>T;1817C>T n/a
2 ccsbBroad304_14383 pLX_304 0% 99.8% 1.9% V5 (not translated due to prior stop codon) 16_17insG;1236C>T;1817C>T n/a
3 TRCN0000481604 ACTACGGAAGCCATTACGAGATAC pLX_317 20.1% 99.8% 1.9% V5 (not translated due to prior stop codon) 16_17insG;1236C>T;1817C>T n/a
4 ccsbBroadEn_15247 pDONR223 64.4% 99.1% 27.7% None (many diffs) n/a
5 ccsbBroad304_15247 pLX_304 0% 99.1% 27.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000474481 AATGAAAAATACAGCGTGCCCAAT pLX_317 16.1% 99.1% 27.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV