Transcript: Human NM_178124.6

Homo sapiens chromosome X open reading frame 40A (CXorf40A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-18
Taxon:
Homo sapiens (human)
Gene:
CXorf40A (91966)
Length:
2388
CDS:
543..1019

Additional Resources:

NCBI RefSeq record:
NM_178124.6
NBCI Gene record:
CXorf40A (91966)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178124.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144967 GCTAAATCATGACACCTTCAA pLKO.1 1059 3UTR 100% 4.950 2.970 N CXorf40A n/a
2 TRCN0000143862 CCAGCTAAATCATGACACCTT pLKO.1 1056 3UTR 100% 2.640 1.584 N CXorf40A n/a
3 TRCN0000143181 GAAAGGAGGCAAGGATGTATT pLKO.1 950 CDS 100% 13.200 6.600 Y CXorf40A n/a
4 TRCN0000163752 GAAAGGAGGCAAGGATGTATT pLKO.1 950 CDS 100% 13.200 6.600 Y CXorf40B n/a
5 TRCN0000122874 GTTCCAGAGAAACCAGCTAAA pLKO.1 1044 3UTR 100% 10.800 5.400 Y CXorf40A n/a
6 TRCN0000143994 CAGAGAAACCAGCTAAATCAT pLKO.1 1048 3UTR 100% 5.625 2.813 Y CXorf40A n/a
7 TRCN0000164541 CAGAAGTACCTGACTGTGATT pLKO.1 894 CDS 100% 4.950 2.475 Y CXorf40B n/a
8 TRCN0000121983 GAAAGGAATGTTCCAGAGAAA pLKO.1 1035 3UTR 100% 4.950 2.475 Y CXorf40A n/a
9 TRCN0000140173 GACCAACCTGAAGCAGAAGTA pLKO.1 881 CDS 100% 4.950 2.475 Y CXorf40A n/a
10 TRCN0000165260 GACCAACCTGAAGCAGAAGTA pLKO.1 881 CDS 100% 4.950 2.475 Y CXorf40B n/a
11 TRCN0000163774 GATGAGGTTGTGGAACTAGAA pLKO.1 846 CDS 100% 4.950 2.475 Y CXorf40B n/a
12 TRCN0000122403 GCAGAAGTACCTGACTGTGAT pLKO.1 893 CDS 100% 4.950 2.475 Y CXorf40A n/a
13 TRCN0000140838 GCCTTATGCTGGCTTTGTCTT pLKO.1 572 CDS 100% 4.950 2.475 Y CXorf40A n/a
14 TRCN0000165839 GCCTTATGCTGGCTTTGTCTT pLKO.1 572 CDS 100% 4.950 2.475 Y CXorf40B n/a
15 TRCN0000159387 GCTTTGTCTTAAATGGAATCA pLKO.1 583 CDS 100% 4.950 2.475 Y CXorf40B n/a
16 TRCN0000164346 CAAGGATGTATTCCAGGTAGA pLKO.1 959 CDS 100% 4.050 2.025 Y CXorf40B n/a
17 TRCN0000139018 CGAAGACTTAACTCCCGATGA pLKO.1 830 CDS 100% 4.050 2.025 Y CXorf40A n/a
18 TRCN0000166567 CGAAGACTTAACTCCCGATGA pLKO.1 830 CDS 100% 4.050 2.025 Y CXorf40B n/a
19 TRCN0000139425 CATACCTAGGAAAGGAGGCAA pLKO.1 941 CDS 100% 2.640 1.320 Y CXorf40A n/a
20 TRCN0000161094 GTACCTGACTGTGATTTCAAA pLKO.1 899 CDS 100% 0.000 0.000 Y CXorf40B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178124.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04566 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04566 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479481 AAGTGCCGTGGGACCCATAGTGGA pLX_317 56% 100% 100% V5 n/a
4 ccsbBroadEn_05700 pDONR223 100% 99.3% 98.7% None 87C>T;159G>T;335T>C n/a
5 ccsbBroad304_05700 pLX_304 0% 99.3% 98.7% V5 87C>T;159G>T;335T>C n/a
6 TRCN0000478460 CTCCCGCACATACTTGTAGAACAG pLX_317 80.7% 99.3% 98.7% V5 87C>T;159G>T;335T>C n/a
Download CSV