Transcript: Human XM_011531762.3

PREDICTED: Homo sapiens WD repeat and FYVE domain containing 3 (WDFY3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDFY3 (23001)
Length:
13972
CDS:
307..10890

Additional Resources:

NCBI RefSeq record:
XM_011531762.3
NBCI Gene record:
WDFY3 (23001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240704 GATCCAACTCAGGCACTAAAT pLKO_005 1924 CDS 100% 13.200 18.480 N WDFY3 n/a
2 TRCN0000179214 GCCATCGTTCAAGAACAGTTT pLKO.1 2273 CDS 100% 4.950 3.960 N WDFY3 n/a
3 TRCN0000240702 CGGATATGGCAAGGATATAAT pLKO_005 1273 CDS 100% 15.000 10.500 N WDFY3 n/a
4 TRCN0000240706 GATGCTTCTAACGACAATTAA pLKO_005 732 CDS 100% 15.000 10.500 N WDFY3 n/a
5 TRCN0000146772 CCACCCTGGTTAAATGTTTAT pLKO.1 812 CDS 100% 13.200 9.240 N WDFY3 n/a
6 TRCN0000240703 TCTTGGTGCCCTCCCTATAAC pLKO_005 1024 CDS 100% 13.200 9.240 N WDFY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11658 pDONR223 100% 11.9% 11.9% None 1_9321del n/a
2 ccsbBroad304_11658 pLX_304 0% 11.9% 11.9% V5 1_9321del n/a
3 TRCN0000481278 ATGTTAGGGCATGGGCCGAAACAA pLX_317 37.5% 11.9% 11.9% V5 1_9321del n/a
4 ccsbBroadEn_15746 pDONR223 0% 7.9% 7.9% None 1_9738del;10440T>C n/a
5 ccsbBroad304_15746 pLX_304 0% 7.9% 7.9% V5 1_9738del;10440T>C n/a
6 TRCN0000481357 CCGACATATTCGCACACAATTTTG pLX_317 47.9% 7.9% 7.9% V5 1_9738del;10290C>T n/a
Download CSV