Transcript: Human NM_001164537.2

Homo sapiens DISC1 scaffold protein (DISC1), transcript variant a, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
DISC1 (27185)
Length:
7180
CDS:
79..2739

Additional Resources:

NCBI RefSeq record:
NM_001164537.2
NBCI Gene record:
DISC1 (27185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118997 CCGAGGAGATTAGATCATTAA pLKO.1 1997 CDS 100% 13.200 6.600 Y DISC1 n/a
2 TRCN0000118998 GAGACGTTACAACAAAGATTA pLKO.1 1294 CDS 100% 13.200 6.600 Y DISC1 n/a
3 TRCN0000119000 GCAGTTGAGAATGATGATTAT pLKO.1 1168 CDS 100% 13.200 6.600 Y DISC1 n/a
4 TRCN0000118999 CATAGGCAAGAAGCTATTGTA pLKO.1 2526 CDS 100% 5.625 2.813 Y DISC1 n/a
5 TRCN0000172710 GAACTCCTGACCTCAAGCAAT pLKO.1 1234 CDS 100% 4.950 2.475 Y ARRDC1-AS1 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1271 CDS 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1271 CDS 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08070 pDONR223 100% 93.8% 93.7% None 791G>A;1116_1211del;2336_2401del n/a
2 ccsbBroad304_08070 pLX_304 0% 93.8% 93.7% V5 791G>A;1116_1211del;2336_2401del n/a
3 TRCN0000477691 ATACGATCGAGTTAACGTCAACCC pLX_317 15.6% 93.8% 93.7% V5 791G>A;1116_1211del;2336_2401del n/a
Download CSV