Transcript: Human XM_024447395.1

PREDICTED: Homo sapiens WD repeat domain 5 (WDR5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR5 (11091)
Length:
3472
CDS:
493..1497

Additional Resources:

NCBI RefSeq record:
XM_024447395.1
NBCI Gene record:
WDR5 (11091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447395.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118048 GCCAAACTATGCTCTAAAGTT pLKO.1 588 CDS 100% 5.625 4.500 N WDR5 n/a
2 TRCN0000419278 CAATTTAACATGCGTTGTGTT pLKO_005 1797 3UTR 100% 4.950 3.960 N WDR5 n/a
3 TRCN0000431459 CCCATTCTCTGCTGCGTAGAT pLKO_005 1933 3UTR 100% 4.950 3.960 N WDR5 n/a
4 TRCN0000433112 AGTAGCTGTTCCTAGTGTATT pLKO_005 1990 3UTR 100% 13.200 9.240 N WDR5 n/a
5 TRCN0000431031 GCGCGTATGATGGGAAATTTG pLKO_005 710 CDS 100% 13.200 9.240 N WDR5 n/a
6 TRCN0000118049 GCTCAGAGGATAACCTTGTTT pLKO.1 1322 CDS 100% 5.625 3.938 N WDR5 n/a
7 TRCN0000118050 CCAACCTTATTGTCTCAGGAT pLKO.1 914 CDS 100% 2.640 1.848 N WDR5 n/a
8 TRCN0000118047 GCCTCCTCTCTGAAGATGATT pLKO.1 1619 3UTR 100% 5.625 3.375 N WDR5 n/a
9 TRCN0000304472 CAAGTTCATCTGCTGATAAAC pLKO_005 674 CDS 100% 13.200 6.600 Y Wdr5 n/a
10 TRCN0000118051 TGGTCGTCAGATTCTAACCTT pLKO.1 775 CDS 100% 3.000 1.500 Y WDR5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447395.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07746 pDONR223 100% 99.9% 100% None 606A>G n/a
2 ccsbBroad304_07746 pLX_304 0% 99.9% 100% V5 606A>G n/a
3 TRCN0000468790 TTAAATAGCTGAGCCATTCAATTC pLX_317 40.9% 99.9% 100% V5 606A>G n/a
4 ccsbBroadEn_03436 pDONR223 100% 79.8% 85% None (many diffs) n/a
5 ccsbBroad304_03436 pLX_304 0% 79.8% 85% V5 (many diffs) n/a
6 TRCN0000476307 AGCTGCTTATCGGCATGTAGCCCG pLX_317 36.5% 79.8% 85% V5 (many diffs) n/a
Download CSV