Transcript: Human NM_004850.5

Homo sapiens Rho associated coiled-coil containing protein kinase 2 (ROCK2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ROCK2 (9475)
Length:
8345
CDS:
501..4667

Additional Resources:

NCBI RefSeq record:
NM_004850.5
NBCI Gene record:
ROCK2 (9475)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004850.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000980 CGTTGCCATATTAAGTGTCAT pLKO.1 4383 CDS 100% 4.950 6.930 N ROCK2 n/a
2 TRCN0000000979 GCCTTGCATATTGGTCTGGAT pLKO.1 3873 CDS 100% 2.640 3.696 N ROCK2 n/a
3 TRCN0000194836 CCTTGATGTCTGTCTATTATT pLKO.1 5629 3UTR 100% 15.000 12.000 N ROCK2 n/a
4 TRCN0000342475 CCTTGATGTCTGTCTATTATT pLKO_005 5629 3UTR 100% 15.000 12.000 N ROCK2 n/a
5 TRCN0000022923 CCCATGGATCAGAGATAATTA pLKO.1 2404 CDS 100% 15.000 10.500 N Rock2 n/a
6 TRCN0000196793 GCTTGCTGGATGGCTTAAATT pLKO.1 634 CDS 100% 15.000 10.500 N ROCK2 n/a
7 TRCN0000342473 GCTTGCTGGATGGCTTAAATT pLKO_005 634 CDS 100% 15.000 10.500 N ROCK2 n/a
8 TRCN0000194956 CAGATGACATTGGACAGTAAA pLKO.1 3816 CDS 100% 13.200 9.240 N ROCK2 n/a
9 TRCN0000196480 GCTATGAAGCTTCTTAGTAAG pLKO.1 855 CDS 100% 10.800 7.560 N ROCK2 n/a
10 TRCN0000342532 GCTATGAAGCTTCTTAGTAAG pLKO_005 855 CDS 100% 10.800 7.560 N ROCK2 n/a
11 TRCN0000194874 CCTTTCAAGATGATAGGTATC pLKO.1 973 CDS 100% 6.000 4.200 N ROCK2 n/a
12 TRCN0000000977 CCTGTGTACCTGATGGAAGTT pLKO.1 5288 3UTR 100% 4.950 3.465 N ROCK2 n/a
13 TRCN0000000981 CCTCAAACAGTCACAGCAGAA pLKO.1 2801 CDS 100% 4.050 2.835 N ROCK2 n/a
14 TRCN0000000978 GCACAGTTTGAGAAGCAGCTA pLKO.1 3552 CDS 100% 2.640 1.584 N ROCK2 n/a
15 TRCN0000342474 GCACAGTTTGAGAAGCAGCTA pLKO_005 3552 CDS 100% 2.640 1.584 N ROCK2 n/a
16 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 6191 3UTR 100% 4.950 2.475 Y DENND6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004850.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11371 pDONR223 100% 50.6% 50.6% None 1_2055del n/a
2 ccsbBroad304_11371 pLX_304 0% 50.6% 50.6% V5 1_2055del n/a
3 TRCN0000480037 GGCGCATCGACCGGGCATATTCTC pLX_317 20% 50.6% 50.6% V5 1_2055del n/a
Download CSV