Transcript: Human XM_011515831.3

PREDICTED: Homo sapiens vitamin K epoxide reductase complex subunit 1 like 1 (VKORC1L1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VKORC1L1 (154807)
Length:
5717
CDS:
16..459

Additional Resources:

NCBI RefSeq record:
XM_011515831.3
NBCI Gene record:
VKORC1L1 (154807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414870 ACAGTTATTACTTGGCATGAC pLKO_005 219 CDS 100% 4.050 5.670 N VKORC1L1 n/a
2 TRCN0000046349 TGGTGTATTAAACCAGCCAAA pLKO.1 168 CDS 100% 4.050 5.670 N VKORC1L1 n/a
3 TRCN0000046350 ACAGTGTCTTTGGACTTATAT pLKO.1 188 CDS 100% 15.000 10.500 N VKORC1L1 n/a
4 TRCN0000426003 AGCAACCATTGCTAGTAATTC pLKO_005 765 3UTR 100% 13.200 9.240 N VKORC1L1 n/a
5 TRCN0000433447 CAATCAAAGACAAGCTTTAAC pLKO_005 678 3UTR 100% 13.200 9.240 N VKORC1L1 n/a
6 TRCN0000046348 CCTGGCCTACATTCTGTACTT pLKO.1 306 CDS 100% 4.950 3.465 N VKORC1L1 n/a
7 TRCN0000440904 TACTTGAACGAGGCCTGGAAG pLKO_005 412 CDS 100% 4.050 2.835 N VKORC1L1 n/a
8 TRCN0000430705 CAATTGTAAAGTGAGCAACCA pLKO_005 752 3UTR 100% 2.640 1.848 N VKORC1L1 n/a
9 TRCN0000439832 GATCCTCATGACGTCCTCCAT pLKO_005 261 CDS 100% 2.640 1.848 N VKORC1L1 n/a
10 TRCN0000046351 CCAAACAGTGTCTTTGGACTT pLKO.1 184 CDS 100% 0.405 0.284 N VKORC1L1 n/a
11 TRCN0000042241 CATTCTGTACTTTGTGCTGAA pLKO.1 315 CDS 100% 4.050 2.430 N Vkorc1l1 n/a
12 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3729 3UTR 100% 4.950 2.475 Y CFLAR n/a
13 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3729 3UTR 100% 4.950 2.475 Y C19orf31 n/a
14 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 3377 3UTR 100% 4.950 2.475 Y NPHS1 n/a
15 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 5239 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 5239 3UTR 100% 4.050 2.025 Y ORAI2 n/a
17 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 5239 3UTR 100% 4.050 2.025 Y P3H4 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5201 3UTR 100% 13.200 6.600 Y LIAS n/a
19 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3894 3UTR 100% 10.800 5.400 Y SMIM11A n/a
20 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3727 3UTR 100% 4.950 2.475 Y ERN2 n/a
21 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3727 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3727 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05083 pDONR223 100% 75.3% 59.6% None (many diffs) n/a
2 ccsbBroad304_05083 pLX_304 0% 75.3% 59.6% V5 (many diffs) n/a
3 TRCN0000468462 ACAGGGTCTATCTTCCCTAACTAG pLX_317 66.6% 75.3% 59.6% V5 (many diffs) n/a
Download CSV