Transcript: Human NM_001284342.3

Homo sapiens vitamin K epoxide reductase complex subunit 1 like 1 (VKORC1L1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
VKORC1L1 (154807)
Length:
5977
CDS:
299..832

Additional Resources:

NCBI RefSeq record:
NM_001284342.3
NBCI Gene record:
VKORC1L1 (154807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284342.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426003 AGCAACCATTGCTAGTAATTC pLKO_005 1025 3UTR 100% 13.200 9.240 N VKORC1L1 n/a
2 TRCN0000433447 CAATCAAAGACAAGCTTTAAC pLKO_005 938 3UTR 100% 13.200 9.240 N VKORC1L1 n/a
3 TRCN0000046348 CCTGGCCTACATTCTGTACTT pLKO.1 566 CDS 100% 4.950 3.465 N VKORC1L1 n/a
4 TRCN0000440904 TACTTGAACGAGGCCTGGAAG pLKO_005 672 CDS 100% 4.050 2.835 N VKORC1L1 n/a
5 TRCN0000430705 CAATTGTAAAGTGAGCAACCA pLKO_005 1012 3UTR 100% 2.640 1.848 N VKORC1L1 n/a
6 TRCN0000439832 GATCCTCATGACGTCCTCCAT pLKO_005 521 CDS 100% 2.640 1.848 N VKORC1L1 n/a
7 TRCN0000042241 CATTCTGTACTTTGTGCTGAA pLKO.1 575 CDS 100% 4.050 2.430 N Vkorc1l1 n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3989 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3989 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 3637 3UTR 100% 4.950 2.475 Y NPHS1 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 5499 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 5499 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 5499 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000046352 GCTCTCCATCTACGCCTACCA pLKO.1 382 CDS 100% 0.880 0.440 Y VKORC1L1 n/a
15 TRCN0000042242 CCTGCTCTCCATCTACGCCTA pLKO.1 379 CDS 100% 0.720 0.360 Y Vkorc1l1 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5461 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4154 3UTR 100% 10.800 5.400 Y SMIM11A n/a
18 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3987 3UTR 100% 4.950 2.475 Y ERN2 n/a
19 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3987 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3987 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284342.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05083 pDONR223 100% 65.2% 42.8% None 193_194ins110;419_531del n/a
2 ccsbBroad304_05083 pLX_304 0% 65.2% 42.8% V5 193_194ins110;419_531del n/a
3 TRCN0000468462 ACAGGGTCTATCTTCCCTAACTAG pLX_317 66.6% 65.2% 42.8% V5 193_194ins110;419_531del n/a
Download CSV