Transcript: Human NM_201279.2

Homo sapiens neuropilin 2 (NRP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
NRP2 (8828)
Length:
6593
CDS:
791..3520

Additional Resources:

NCBI RefSeq record:
NM_201279.2
NBCI Gene record:
NRP2 (8828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201279.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028976 CCGGATTGCTAATGAACAGAT pLKO.1 1648 CDS 100% 4.950 6.930 N Nrp2 n/a
2 TRCN0000063309 CGACTGCAAGTATGACTTTAT pLKO.1 1033 CDS 100% 13.200 10.560 N NRP2 n/a
3 TRCN0000063310 GCGCAAGTTCAAAGTCTCCTA pLKO.1 2353 CDS 100% 2.640 2.112 N NRP2 n/a
4 TRCN0000063312 CCTCAACTTCAACCCTCACTT pLKO.1 997 CDS 100% 4.950 3.465 N NRP2 n/a
5 TRCN0000063308 GCCATTGATGACATTCGGATA pLKO.1 3143 CDS 100% 4.050 2.835 N NRP2 n/a
6 TRCN0000063311 CGTTTCCAGATGACAGGAATT pLKO.1 2826 CDS 100% 0.000 0.000 N NRP2 n/a
7 TRCN0000028974 CCTCACTTTGAAATCGAGAAA pLKO.1 1010 CDS 100% 4.950 3.465 N Nrp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201279.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02025 pDONR223 100% 98.1% 98.1% None 1404T>C;2424_2425ins51 n/a
2 ccsbBroad304_02025 pLX_304 0% 98.1% 98.1% V5 1404T>C;2424_2425ins51 n/a
3 TRCN0000470036 AGGTAGGCTCTCAACGCTGCCTCA pLX_317 16.7% 98.1% 98.1% V5 1404T>C;2424_2425ins51 n/a
4 ccsbBroadEn_11311 pDONR223 100% 10.1% 9.1% None (many diffs) n/a
5 ccsbBroad304_11311 pLX_304 0% 10.1% 9.1% V5 (many diffs) n/a
6 TRCN0000469807 CGAGGCGTACGCATAGCAACATTA pLX_317 100% 10.1% 9.1% V5 (many diffs) n/a
Download CSV