Transcript: Human NM_001040056.3

Homo sapiens mitogen-activated protein kinase 3 (MAPK3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
MAPK3 (5595)
Length:
1085
CDS:
12..1085

Additional Resources:

NCBI RefSeq record:
NM_001040056.3
NBCI Gene record:
MAPK3 (5595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040056.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006151 CGACCTTAAGATTTGTGATTT pLKO.1 545 CDS 100% 13.200 18.480 N MAPK3 n/a
2 TRCN0000219700 TCATCGGCATCCGAGACATTC pLKO.1 310 CDS 100% 10.800 15.120 N MAPK3 n/a
3 TRCN0000006152 CTATACCAAGTCCATCGACAT pLKO.1 674 CDS 100% 4.050 5.670 N MAPK3 n/a
4 TRCN0000219701 CGTGCTCCACCGAGATCTAAA pLKO.1 494 CDS 100% 13.200 10.560 N MAPK3 n/a
5 TRCN0000234921 ACCTGCTGGACCGGATGTTAA pLKO_005 925 CDS 100% 13.200 9.240 N Mapk3 n/a
6 TRCN0000257297 CAACACCACCTGCGACCTTAA pLKO_005 533 CDS 100% 10.800 7.560 N Mapk3 n/a
7 TRCN0000010998 GCAGCTGAGCAATGACCATAT pLKO.1 419 CDS 100% 10.800 7.560 N MAPK3 n/a
8 TRCN0000195323 CAACATGAAGGCCCGAAACTA pLKO.1 830 CDS 100% 5.625 3.938 N MAPK3 n/a
9 TRCN0000006150 CCTGAATTGTATCATCAACAT pLKO.1 815 CDS 100% 4.950 3.465 N MAPK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040056.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488722 TGATGCAACTCCCATTCACCCTGT pLX_317 26.5% 92.8% 88.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488329 TGGGGCGTGGGTCTCATTGTATCG pLX_317 29.6% 92.8% 88.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488687 GCTGATGTACGTTCGTCCCGGGCT pLX_317 29.4% 92.7% 87.9% V5 (many diffs) n/a
4 ccsbBroadEn_14800 pDONR223 100% 92.5% 37.5% None (many diffs) n/a
5 ccsbBroad304_14800 pLX_304 39.5% 92.5% 37.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000479597 ACAATAAGTATTACTCAAATACAA pLX_317 25.8% 92.5% 37.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV